Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-Seq-Based Analysis Reveals Heterogeneity in Mature 16S rRNA 3' Termini and Extended Anti-Shine-Dalgarno Motifs in Bacterial Species.

ABSTRACT: We present an RNA-Seq based approach to map 3' end sequences of mature 16S rRNA (3' TAIL) in bacteria with single-base specificity. Our results show that 3' TAILs are heterogeneous among species; they contain the core CCUCC anti-Shine-Dalgarno motif, but vary in downstream lengths. Importantly, our findings rectify the mis-annotated 16S rRNAs in 11 out of 13 bacterial species studied herein (covering Cyanobacteria, Deinococcus-Thermus, Firmicutes, Proteobacteria, Tenericutes, and Spirochaetes). Furthermore, our results show that species-specific 3' TAIL boundaries are retained due to their high complementarity with preferred Shine-Dalgarno sequences, suggesting that 3' TAIL bases downstream of the canonical CCUCC motif play a more important role in translation initiation than previously reported.

SUBMITTER: Silke JR

PROVIDER: S-EPMC6288834 | biostudies-literature | 2018 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

RNA-Seq-Based Analysis Reveals Heterogeneity in Mature 16S rRNA 3' Termini and Extended Anti-Shine-Dalgarno Motifs in Bacterial Species.

Silke Jordan R JR Wei Yulong Y Xia Xuhua X

G3 (Bethesda, Md.) 20181210 12

We present an RNA-Seq based approach to map 3' end sequences of mature 16S rRNA (3' TAIL) in bacteria with single-base specificity. Our results show that 3' TAILs are heterogeneous among species; they contain the core CCUCC anti-Shine-Dalgarno motif, but vary in downstream lengths. Importantly, our findings rectify the mis-annotated 16S rRNAs in 11 out of 13 bacterial species studied herein (covering Cyanobacteria, Deinococcus-Thermus, Firmicutes, Proteobacteria, Tenericutes, and Spirochaetes). ...[more]

PMID: 30355764

Similar Datasets

Re-annotation of 12,495 prokaryotic 16S rRNA 3' ends and analysis of Shine-Dalgarno and anti-Shine-Dalgarno sequences.

Project description:We examined 20,648 prokaryotic unique taxids with respect to the annotation of the 3' end of the 16S rRNA, which contains the anti-Shine-Dalgarno sequence. We used the sequence of highly conserved helix 45 of the 16S rRNA as a guide. By this criterion, 8,153 annotated 3' ends correctly included the anti-Shine-Dalgarno sequence, but 12,495 were foreshortened or otherwise mis-annotated, missing part or all of the anti-Shine-Dalgarno sequence, which immediately follows helix 45. We re-annotated, giving a total of 20,648 16S rRNA 3' ends. The vast majority indeed contained a consensus anti-Shine-Dalgarno sequence, embedded in a highly conserved 13 base "tail". However, 128 exceptional organisms had either a variant anti-Shine-Dalgarno, or no recognizable anti-Shine-Dalgarno, in their 16S rRNA(s). For organisms both with and without an anti-Shine-Dalgarno, we identified the Shine-Dalgarno motifs actually enriched in front of each organism's open reading frames. This showed to what extent the Shine-Dalgarno motifs correlated with anti-Shine Dalgarno motifs. In general, organisms whose rRNAs lacked a perfect anti-Shine-Dalgarno motif also lacked a recognizable Shine-Dalgarno. For organisms whose 16S rRNAs contained a perfect anti-Shine-Dalgarno motif, a variety of results were obtained. We found one genus, Alteromonas, where several taxids apparently maintain two different types of 16S rRNA genes, with different, but conserved, antiSDs. The fact that some organisms do not seem to have or use Shine-Dalgarno motifs supports the idea that prokaryotes have other robust mechanisms for recognizing start codons for translation.

| S-EPMC6107228 | biostudies-literature

The Frequency of Internal Shine-Dalgarno-like Motifs in Prokaryotes.

Project description:In prokaryotes, translation initiation typically depends on complementary binding between a G-rich Shine-Dalgarno (SD) motif in the 5' untranslated region of mRNAs, and the 3' tail of the 16S ribosomal RNA (the anti-SD sequence). In some cases, internal SD-like motifs in the coding region generate "programmed" ribosomal pauses that are beneficial for protein folding or accurate targeting. On the other hand, such pauses can also reduce protein production, generating purifying selection against internal SD-like motifs. This selection should be stronger in GC-rich genomes that are more likely to harbor the G-rich SD motif. However, the nature and consequences of selection acting on internal SD-like motifs within genomes and across species remains unclear. We analyzed the frequency of SD-like hexamers in the coding regions of 284 prokaryotes (277 with known anti-SD sequences and 7 without a typical SD mechanism). After accounting for GC content, we found that internal SD-like hexamers are avoided in 230 species, including three without a typical SD mechanism. The degree of avoidance was higher in GC-rich genomes, mesophiles, and N-terminal regions of genes. In contrast, 54 species either showed no signature of avoidance or were enriched in internal SD-like motifs. C-terminal gene regions were relatively enriched in SD-like hexamers, particularly for genes in operons or those followed closely by downstream genes. Together, our results suggest that the frequency of internal SD-like hexamers is governed by multiple factors including GC content and genome organization, and further empirical work is necessary to understand the evolution and functional roles of these motifs.

| S-EPMC4943179 | biostudies-literature

Conserved small mRNA with an unique, extended Shine-Dalgarno sequence.

Project description:Up to now, very small protein-coding genes have remained unrecognized in sequenced genomes. We identified an mRNA of 165 nucleotides (nt), which is conserved in Bradyrhizobiaceae and encodes a polypeptide with 14 amino acid residues (aa). The small mRNA harboring a unique Shine-Dalgarno sequence (SD) with a length of 17 nt was localized predominantly in the ribosome-containing P100 fraction of Bradyrhizobium japonicum USDA 110. Strong interaction between the mRNA and 30S ribosomal subunits was demonstrated by their co-sedimentation in sucrose density gradient. Using translational fusions with egfp, we detected weak translation and found that it is impeded by both the extended SD and the GTG start codon (instead of ATG). Biophysical characterization (CD- and NMR-spectroscopy) showed that synthesized polypeptide remained unstructured in physiological puffer. Replacement of the start codon by a stop codon increased the stability of the transcript, strongly suggesting additional posttranscriptional regulation at the ribosome. Therefore, the small gene was named rreB (ribosome-regulated expression in Bradyrhizobiaceae). Assuming that the unique ribosome binding site (RBS) is a hallmark of rreB homologs or similarly regulated genes, we looked for similar putative RBS in bacterial genomes and detected regions with at least 16 nt complementarity to the 3'-end of 16S rRNA upstream of sORFs in Caulobacterales, Rhizobiales, Rhodobacterales and Rhodospirillales. In the Rhodobacter/Roseobacter lineage of ?-proteobacteria the corresponding gene (rreR) is conserved and encodes an 18 aa protein. This shows how specific RBS features can be used to identify new genes with presumably similar control of expression at the RNA level.

| S-EPMC5711450 | biostudies-literature

An extended Shine-Dalgarno sequence in mRNA functionally bypasses a vital defect in initiator tRNA.

Project description:Initiator tRNAs are special in their direct binding to the ribosomal P-site due to the hallmark occurrence of the three consecutive G-C base pairs (3GC pairs) in their anticodon stems. How the 3GC pairs function in this role, has remained unsolved. We show that mutations in either the mRNA or 16S rRNA leading to extended interaction between the Shine-Dalgarno (SD) and anti-SD sequences compensate for the vital need of the 3GC pairs in tRNA(fMet) for its function in Escherichia coli. In vivo, the 3GC mutant tRNA(fMet) occurred less abundantly in 70S ribosomes but normally on 30S subunits. However, the extended SD:anti-SD interaction increased its occurrence in 70S ribosomes. We propose that the 3GC pairs play a critical role in tRNA(fMet) retention in ribosome during the conformational changes that mark the transition of 30S preinitiation complex into elongation competent 70S complex. Furthermore, treating cells with kasugamycin, decreasing ribosome recycling factor (RRF) activity or increasing initiation factor 2 (IF2) levels enhanced initiation with the 3GC mutant tRNA(fMet), suggesting that the 70S mode of initiation is less dependent on the 3GC pairs in tRNA(fMet).

| S-EPMC4210040 | biostudies-literature

Evidence for context-dependent complementarity of non-Shine-Dalgarno ribosome binding sites to Escherichia coli rRNA.

Project description:While the ribosome has evolved to function in complex intracellular environments, these contexts do not easily allow for the study of its inherent capabilities. We have used a synthetic, well-defined Escherichia coli (E. coli)-based translation system in conjunction with ribosome display, a powerful in vitro selection method, to identify ribosome binding sites (RBSs) that can promote the efficient translation of messenger RNAs (mRNAs) with a leader length representative of natural E. coli mRNAs. In previous work, we used a longer leader sequence and unexpectedly recovered highly efficient cytosine-rich sequences with complementarity to the 16S ribosomal RNA (rRNA) and similarity to eukaryotic RBSs. In the current study, Shine-Dalgarno (SD) sequences were prevalent, but non-SD sequences were also heavily enriched and were dominated by novel guanine- and uracil-rich motifs that showed statistically significant complementarity to the 16S rRNA. Additionally, only SD motifs exhibited position-dependent decreases in sequence entropy, indicating that non-SD motifs likely operate by increasing the local concentration of ribosomes in the vicinity of the start codon, rather than by a position-dependent mechanism. These results further support the putative generality of mRNA-rRNA complementarity in facilitating mRNA translation but also suggest that context (e.g., leader length and composition) dictates the specific subset of possible RBSs that are used for efficient translation of a given transcript.

| S-EPMC3666857 | biostudies-literature

Selection of Shine-Dalgarno sequences in plastids.

Project description:Like bacterial genes, most plastid (chloroplast) genes are arranged in operons and transcribed as polycistronic mRNAs. Plastid protein biosynthesis occurs on bacterial-type 70S ribosomes and translation initiation of many (but not all) mRNAs is mediated by Shine-Dalgarno (SD) sequences. To study the mechanisms of SD sequence recognition, we have analyzed translation initiation from mRNAs containing multiple SD sequences. Comparing translational efficiencies of identical transgenic mRNAs in Escherichia coli and plastids, we find surprising differences between the two systems. Most importantly, while internal SD sequences are efficiently recognized in E. coli, plastids exhibit a bias toward utilizing predominantly the 5'-most SD sequence. We propose that inefficient recognition of internal SD sequences provides the raison d'être for most plastid polycistronic transcripts undergoing post-transcriptional cleavage into monocistronic mRNAs.

| S-EPMC3045613 | biostudies-literature

Global fitness landscapes of the Shine-Dalgarno sequence.

Project description:Shine-Dalgarno sequences (SD) in prokaryotic mRNA facilitate protein translation by pairing with rRNA in ribosomes. Although conventionally defined as AG-rich motifs, recent genomic surveys reveal great sequence diversity, questioning how SD functions. Here, we determined the molecular fitness (i.e., translation efficiency) of 49 synthetic 9-nt SD genotypes in three distinct mRNA contexts in Escherichia coli We uncovered generic principles governing the SD fitness landscapes: (1) Guanine contents, rather than canonical SD motifs, best predict the fitness of both synthetic and endogenous SD; (2) the genotype-fitness correlation of SD promotes its evolvability by steadily supplying beneficial mutations across fitness landscapes; and (3) the frequency and magnitude of deleterious mutations increase with background fitness, and adjacent nucleotides in SD show stronger epistasis. Epistasis results from disruption of the continuous base pairing between SD and rRNA. This "chain-breaking" epistasis creates sinkholes in SD fitness landscapes and may profoundly impact the evolution and function of prokaryotic translation initiation and other RNA-mediated processes. Collectively, our work yields functional insights into the SD sequence variation in prokaryotic genomes, identifies a simple design principle to guide bioengineering and bioinformatic analysis of SD, and illuminates the fundamentals of fitness landscapes and molecular evolution.

| S-EPMC7263185 | biostudies-literature

Predicting Shine-Dalgarno sequence locations exposes genome annotation errors.

Project description:In prokaryotes, Shine-Dalgarno (SD) sequences, nucleotides upstream from start codons on messenger RNAs (mRNAs) that are complementary to ribosomal RNA (rRNA), facilitate the initiation of protein synthesis. The location of SD sequences relative to start codons and the stability of the hybridization between the mRNA and the rRNA correlate with the rate of synthesis. Thus, accurate characterization of SD sequences enhances our understanding of how an organism's transcriptome relates to its cellular proteome. We implemented the Individual Nearest Neighbor Hydrogen Bond model for oligo-oligo hybridization and created a new metric, relative spacing (RS), to identify both the location and the hybridization potential of SD sequences by simulating the binding between mRNAs and single-stranded 16S rRNA 3' tails. In 18 prokaryote genomes, we identified 2,420 genes out of 58,550 where the strongest binding in the translation initiation region included the start codon, deviating from the expected location for the SD sequence of five to ten bases upstream. We designated these as RS+1 genes. Additional analysis uncovered an unusual bias of the start codon in that the majority of the RS+1 genes used GUG, not AUG. Furthermore, of the 624 RS+1 genes whose SD sequence was associated with a free energy release of less than -8.4 kcal/mol (strong RS+1 genes), 384 were within 12 nucleotides upstream of in-frame initiation codons. The most likely explanation for the unexpected location of the SD sequence for these 384 genes is mis-annotation of the start codon. In this way, the new RS metric provides an improved method for gene sequence annotation. The remaining strong RS+1 genes appear to have their SD sequences in an unexpected location that includes the start codon. Thus, our RS metric provides a new way to explore the role of rRNA-mRNA nucleotide hybridization in translation initiation.

| S-EPMC1463019 | biostudies-literature

Within-Gene Shine-Dalgarno Sequences Are Not Selected for Function.

Project description:The Shine-Dalgarno (SD) sequence motif facilitates translation initiation and is frequently found upstream of bacterial start codons. However, thousands of instances of this motif occur throughout the middle of protein coding genes in a typical bacterial genome. Here, we use comparative evolutionary analysis to test whether SD sequences located within genes are functionally constrained. We measure the conservation of SD sequences across Enterobacteriales, and find that they are significantly less conserved than expected. Further, the strongest SD sequences are the least conserved whereas we find evidence of conservation for the weakest possible SD sequences given amino acid constraints. Our findings indicate that most SD sequences within genes are likely to be deleterious and removed via selection. To illustrate the origin of these deleterious costs, we show that ATG start codons are significantly depleted downstream of SD sequences within genes, highlighting the constraint that these sequences impose on the surrounding nucleotides to minimize the potential for erroneous translation initiation.

| S-EPMC6188533 | biostudies-literature

Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences.

Project description:Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome.

| S-EPMC3927391 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data