Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Microwave-Assisted Synthesis of Nanoporous Aluminum-Based Coordination Polymers as Catalysts for Selective Sulfoxidation Reaction.

ABSTRACT: A series of aluminum-based coordination polymers or metal?organic frameworks (Al?MOFs), i.e., DUT-4, DUT-5, MIL-53, NH?-MIL-53, and MIL-100, have been facile prepared by microwave (MW)-assisted reactions and used as catalysts for selective sulfoxidation reactions. The MW-assisted synthesis drastically reduced the reaction time from few days to hours. The prepared MOFs have smaller and uniform particle sizes and better yield compared to conventional hydrothermal method. Furthermore, the Al?MOFs have been successfully demonstrated as catalysts in oxidation reaction of methyl phenyl sulfide with H?O? as oxidant, even under mild conditions, with more than 95% conversion.

SUBMITTER: Vinu M

PROVIDER: S-EPMC6418783 | biostudies-literature | 2017 Oct

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Microwave-Assisted Synthesis of Nanoporous Aluminum-Based Coordination Polymers as Catalysts for Selective Sulfoxidation Reaction.

Vinu Madhan M Lin Wei-Cheng WC Senthil Raja Duraisamy D Han Jeng-Liang JL Lin Chia-Her CH

Polymers 20171011 10

A series of aluminum-based coordination polymers or metal⁻organic frameworks (Al⁻MOFs), i.e., DUT-4, DUT-5, MIL-53, NH₂-MIL-53, and MIL-100, have been facile prepared by microwave (MW)-assisted reactions and used as catalysts for selective sulfoxidation reactions. The MW-assisted synthesis drastically reduced the reaction time from few days to hours. The prepared MOFs have smaller and uniform particle sizes and better yield compared to conventional hydrothermal method. Furthermore, the Al⁻MOFs h ...[more]

PMID: 30965801

Similar Datasets

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

Project description:The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or β-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

| S-EPMC8835054 | biostudies-literature

Pyrene Carboxylate Ligand Based Coordination Polymers for Microwave-Assisted Solvent-Free Cyanosilylation of Aldehydes.

Project description:The new coordination polymers (CPs) [Zn(μ-1κO1:1κO2-L)(H2O)2]n·n(H2O) (1) and [Cd(μ4-1κO1O2:2κN:3,4κO3-L)(H2O)]n·n(H2O) (2) are reported, being prepared by the solvothermal reactions of 5-{(pyren-4-ylmethyl)amino}isophthalic acid (H2L) with Zn(NO3)2.6H2O or Cd(NO3)2.4H2O, respectively. They were synthesized in a basic ethanolic medium or a DMF:H2O mixture, respectively. These compounds were characterized by single-crystal X-ray diffraction, FTIR spectroscopy, thermogravimetric and elemental analysis. The single-crystal X-ray diffraction analysis revealed that compound 1 is a one dimensional linear coordination polymer, whereas 2 presents a two dimensional network. In both compounds, the coordinating ligand (L2-) is twisted due to the rotation of the pyrene ring around the CH2-NH bond. In compound 1, the Zn(II) metal ion has a tetrahedral geometry, whereas, in 2, the dinuclear [Cd2(COO)2] moiety acts as a secondary building unit and the Cd(II) ion possesses a distorted octahedral geometry. Recently, several CPs have been explored for the cyanosilylation reaction under conventional conditions, but microwave-assisted cyanosilylation of aldehydes catalyzed by CPs has not yet been well studied. Thus, we have tested the solvent-free microwave-assisted cyanosilylation reactions of different aldehydes, with trimethylsilyl cyanide, using our synthesized compounds, which behave as highly active heterogeneous catalysts. The coordination polymer 1 is more effective than 2, conceivably due to the higher Lewis acidity of the Zn(II) than the Cd(II) center and to a higher accessibility of the metal centers in the former framework. We have also checked the heterogeneity and recyclability of these coordination polymers, showing that they remain active at least after four recyclings.

| S-EPMC7922377 | biostudies-literature

Mixing of immiscible polymers using nanoporous coordination templates.

Project description:The establishment of methodologies for the mixing of immiscible substances is highly desirable to facilitate the development of fundamental science and materials technology. Herein we describe a new protocol for the compatibilization of immiscible polymers at the molecular level using porous coordination polymers (PCPs) as removable templates. In this process, the typical immiscible polymer pair of polystyrene (PSt) and poly(methyl methacrylate) (PMMA) was prepared via the successive homopolymerizations of their monomers in a PCP to distribute the polymers inside the PCP particles. Subsequent dissolution of the PCP frameworks in a chelator solution affords a PSt/PMMA blend that is homogeneous in the range of several nanometers. Due to the unusual compatibilization, the thermal properties of the polymer blend are remarkably improved compared with the conventional solvent-cast blend. This method is also applicable to the compatibilization of PSt and polyacrylonitrile, which have very different solubility parameters.

| S-EPMC4506999 | biostudies-literature

Mild, Selective Sulfoxidation with Molybdenum(VI) <i>cis</i>-Dioxo Catalysts.

Project description:Three molybdenum(VI) cis-dioxo catalysts (8-10) were synthesized with the goal of developing stable and selective oxidation catalysts for sulfoxidation. Their reactivities were investigated with a variety of substrates. We have demonstrated the usefulness of these catalysts for the chemoselective sulfoxidation of sulfides in the presence of reactive moieties, which has important applications for total synthesis processes. Notably, these catalysts are able to oxidize compounds analogous to sulfur mustard and can be used as an alternative to sodium periodate or meta-chloroperoxybenzoic acid (m-CPBA) for the oxidation of various organic sulfides without sacrificing total conversion. As the catalysts are tolerant of water and hydrogen peroxide, they allow for the design of completely green oxidation reactions, particularly for sulfur-containing amino acids.

| S-EPMC6641015 | biostudies-literature

1D Copper(II)-Aroylhydrazone Coordination Polymers: Magnetic Properties and Microwave Assisted Oxidation of a Secondary Alcohol.

Project description:The 1D Cu(II) coordination polymers [Cu3(L1)(NO3)4(H2O)2]n (1) and [Cu2(H2L2)(NO3)(H2O)2]n(NO3)n (2) have been synthesized using the aroylhyrazone Schiff bases N' 1,N' 2-bis(pyridin-2-ylmethylene)oxalohydrazide (H2L1) and N' 1,N' 3-bis(2-hydroxybenzylidene)malonohydrazide (H4L2), respectively. They have been characterized by elemental analysis, infrared (IR) spectroscopy, UV-Vis spectroscopy, electrospray ionization mass spectrometry (ESI-MS), single crystal X-ray diffraction and variable temperature magnetic susceptibility measurements (for 2). The ligand (L1)2- coordinates in the iminol form in 1, whereas the amide coordination is observed for (H2L2)2- in 2. Either the ligand bridge or the nitrate bridge in 2 mediates weak antiferromagnetic coupling. The catalytic performance of 1 and 2 has been investigated toward the solvent-free microwave-assisted oxidation of a secondary alcohol (1-phenylethanol used as model substrate). At 120°C and in the presence of the nitroxyl radical 2,2,6,6-tetramethylpiperydil-1-oxyl (TEMPO), the complete conversion of 1-phenylethanol into acetophenone occurs with TOFs up to 1,200 h-1.

| S-EPMC7069101 | biostudies-literature

Polyaromatic Group Embedded Cd(II)-Coordination Polymers for Microwave-Assisted Solvent-Free Strecker-Type Cyanation of Acetals.

Project description:In this work, two new 1D Cd(II) coordination polymers (CPs), [Cd(L1)(NMF)2]n (1) and [Cd(L2)(DMF)(H2O)2]n·n(H2O) (2), have been synthesized, characterized and employed as catalysts for the microwave-assisted solvent-free Strecker-type cyanation of different acetals. Solvothermal reaction between the pro-ligand, 5-{(pyren-1-ylmethyl)amino}isophthalic acid (H2L1) or 5-{(anthracen-9-ylmethyl)amino}isophthalic acid (H2L2), and Cd(NO3)2.6H2O in the presence of NMF or DMF:THF solvent, produces the coordination polymer 1 or 2, respectively. These frameworks were characterized by single-crystal and powder X-ray diffraction analyses, ATR-FTIR, elemental and thermogravimetry analysis. Their structural analysis revealed that both CPs show one-dimensional structures, but CP 1 has a 1D double chain type structure whereas CP 2 is a simple one-dimensional network. In CP 1, the dinuclear {Cd2(COO)4} unit acts as a secondary building unit (SBU) and the assembly of dinuclear SBUs with deprotonated ligand (L12-) led to the formation of a 1D double chain framework. In contrast, no SBU was observed in CP 2. To test the catalytic effectiveness of these 1D compounds, the solvent-free Strecker-type cyanation reactions of different acetals in presence of trimethylsilyl cyanide (TMSCN) was studied with CPs 1 and 2 as heterogenous catalysts. CP 1 displays a higher activity (yield 95%) compared to CP 2 (yield 84%) after the same reaction time. This is accounted for by the strong hydrogen bonding packing network in CP 2 that hampers the accessibility of the metal centers, and the presence of the dinuclear Cd(II) SBU in CP 1 which can promote the catalytic process in comparison with the mononuclear Cd(II) center in CP 2. Moreover, the recyclability and heterogeneity of both CPs were tested, demonstrating that they can be recyclable for at least for four cycles without losing their structural integrity and catalytic activity.

| S-EPMC9919643 | biostudies-literature

Galvanic Replacement Reaction as a Route to Prepare Nanoporous Aluminum for UV Plasmonics.

Project description:There is a growing interest in extending plasmonics applications into the ultraviolet region of the electromagnetic spectrum. Noble metals are commonly used in plasmonic, but their intrinsic optical properties limit their use above 350 nm. Aluminum is probably the most suitable material for UV plasmonics, and in this work we fabricated substrates of nanoporous aluminum starting from an alloy of Al2Mg3. The porous metal is obtained by means of a galvanic replacement reaction. Such nanoporous metal can be exploited to achieve a plasmonic material suitable for enhanced UV Raman spectroscopy and fluorescence. Thanks to the large surface to volume ratio, this material represents a powerful platform for promoting interaction between plasmonic substrates and molecules in the UV.

| S-EPMC7023067 | biostudies-literature

Microwave-assisted design of nanoporous graphene membrane for ultrafast and switchable organic solvent nanofiltration.

Project description:Layered two-dimensional materials can potentially be utilized for organic solvent nanofiltration (OSN) membrane fabrication owing to their precise molecular sieving by the interlayer structure and excellent stability in harsh conditions. Nevertheless, the extensive tortuosity of nanochannels and bulky solvent molecules impede rapid permeability. Herein, nanoporous graphene (NG) with a high density of sp2 carbon domain was synthesized via sequential thermal pore activation of graphene oxide (GO) and microwave-assisted reduction. Due to the smooth sp2 carbon domain surfaces and dense nanopores, the microwave-treated nanoporous graphene membrane exhibited ultrafast organic solvent permeance (e.g., IPA: 2278 LMH/bar) with excellent stability under practical cross-flow conditions. Furthermore, the membrane molecular weight cut-off (MWCO) is switchable from 500 Da size of molecule to sub-nanometer-size molecules depending on the solvent type, and this switching occurs spontaneously with solvent change. These properties indicate feasibility of multiple (both binary and ternary) organic mixture separation using a single membrane. The nanochannel structure effect on solvent transport is also investigated using computation calculations.

| S-EPMC9935848 | biostudies-literature

Gas confinement in compartmentalized coordination polymers for highly selective sorption.

Project description:Discrimination between different gases is an essential aspect for industrial and environmental applications involving sensing and separation. Several classes of porous materials have been used in this context, including zeolites and more recently MOFs. However, to reach high selectivities for the separation of gas mixtures is a challenging task that often requires the understanding of the specific interactions established between the porous framework and the gases. Here we propose an approach to obtain an enhanced selectivity based on the use of compartmentalized coordination polymers, named CCP-1 and CCP-2, which are crystalline materials comprising isolated discrete cavities. These compartmentalized materials are excellent candidates for the selective separation of CO2 from methane and nitrogen. A complete understanding of the sorption process is accomplished with the use of complementary experimental techniques including X-ray diffraction, adsorption studies, inelastic- and quasi-elastic neutron scattering, magnetic measurements and molecular dynamics calculations.

| S-EPMC5412580 | biostudies-literature

Ni(ii)-based coordination polymers for efficient electrocatalytic oxygen evolution reaction.

Project description:The exploration of highly efficient, stable and cheap water oxidation electrocatalysts using earth-abundant elements is still a great challenge. Herein, alkaline-stable cationic Ni(ii) coordination polymers (Ni-CPs) were successfully obtained under hydrothermal conditions, which could stabilize the incorporation of Fe(iii) to form Fe-immobilized Fe@Ni-CPs. The newly developed Ni-based CPs were used for the first time as an effective electrocatalyst for the oxygen evolution reaction in strong alkaline media.

| S-EPMC9090564 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data