Browse
Submit Data
Databases
API
Help

Dataset Information

25 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Mild, Selective Sulfoxidation with Molybdenum(VI) cis-Dioxo Catalysts.

ABSTRACT: Three molybdenum(VI) cis-dioxo catalysts (8-10) were synthesized with the goal of developing stable and selective oxidation catalysts for sulfoxidation. Their reactivities were investigated with a variety of substrates. We have demonstrated the usefulness of these catalysts for the chemoselective sulfoxidation of sulfides in the presence of reactive moieties, which has important applications for total synthesis processes. Notably, these catalysts are able to oxidize compounds analogous to sulfur mustard and can be used as an alternative to sodium periodate or meta-chloroperoxybenzoic acid (m-CPBA) for the oxidation of various organic sulfides without sacrificing total conversion. As the catalysts are tolerant of water and hydrogen peroxide, they allow for the design of completely green oxidation reactions, particularly for sulfur-containing amino acids.

SUBMITTER: Cantwell KE

PROVIDER: S-EPMC6641015 | biostudies-literature | 2017 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Mild, Selective Sulfoxidation with Molybdenum(VI) cis-Dioxo Catalysts.

Cantwell Kelsey E KE Fanwick Phillip E PE Abu-Omar Mahdi M MM

ACS omega 20170504 5

Three molybdenum(VI) cis-dioxo catalysts (8-10) were synthesized with the goal of developing stable and selective oxidation catalysts for sulfoxidation. Their reactivities were investigated with a variety of substrates. We have demonstrated the usefulness of these catalysts for the chemoselective sulfoxidation of sulfides in the presence of reactive moieties, which has important applications for total synthesis processes. Notably, these catalysts are able to oxidize compound ...[more]

PMID: 31457541

Similar Datasets

Molybdenum chloride catalysts for Z-selective olefin metathesis reactions.

Project description:The development of catalyst-controlled stereoselective olefin metathesis processes has been a pivotal recent advance in chemistry. The incorporation of appropriate ligands within complexes based on molybdenum, tungsten and ruthenium has led to reactivity and selectivity levels that were previously inaccessible. Here we show that molybdenum monoaryloxide chloride complexes furnish higher-energy (Z) isomers of trifluoromethyl-substituted alkenes through cross-metathesis reactions with the commercially available, inexpensive and typically inert Z-1,1,1,4,4,4-hexafluoro-2-butene. Furthermore, otherwise inefficient and non-stereoselective transformations with Z-1,2-dichloroethene and 1,2-dibromoethene can be effected with substantially improved efficiency and Z selectivity. The use of such molybdenum monoaryloxide chloride complexes enables the synthesis of representative biologically active molecules and trifluoromethyl analogues of medicinally relevant compounds. The origins of the activity and selectivity levels observed, which contradict previously proposed principles, are elucidated with the aid of density functional theory calculations.

| S-EPMC5748242 | biostudies-literature

Microwave-Assisted Synthesis of Nanoporous Aluminum-Based Coordination Polymers as Catalysts for Selective Sulfoxidation Reaction.

Project description:A series of aluminum-based coordination polymers or metal⁻organic frameworks (Al⁻MOFs), i.e., DUT-4, DUT-5, MIL-53, NH₂-MIL-53, and MIL-100, have been facile prepared by microwave (MW)-assisted reactions and used as catalysts for selective sulfoxidation reactions. The MW-assisted synthesis drastically reduced the reaction time from few days to hours. The prepared MOFs have smaller and uniform particle sizes and better yield compared to conventional hydrothermal method. Furthermore, the Al⁻MOFs have been successfully demonstrated as catalysts in oxidation reaction of methyl phenyl sulfide with H₂O₂ as oxidant, even under mild conditions, with more than 95% conversion.

| S-EPMC6418783 | biostudies-literature

Cis-selective ring-opening metathesis polymerization with ruthenium catalysts.

Project description:Cis-selective ring-opening metathesis polymerization of several monocyclic alkenes as well as norbornene and oxanorbornene-type monomers using a C-H activated, ruthenium-based metathesis catalyst is reported. The cis content of the isolated polymers depended heavily on the monomer structure and temperature. A cis content as high as 96% could be obtained by lowering the temperature of the polymerization.

| S-EPMC3278323 | biostudies-literature

Olefin Metathesis Catalysts Generated In Situ from Molybdenum(VI)-Oxo Complexes by Tuning Pendant Ligands.

Project description:Tailored molybdenum(VI)-oxo complexes of the form MoOCl2 (OR)2 (OEt2 ) catalyse olefin metathesis upon reaction with an organosilicon reducing agent at 70 °C, in the presence of olefins. While this reactivity parallels what has recently been observed for the corresponding classical heterogeneous catalysts based on supported metal oxide under similar conditions, the well-defined nature of our starting molecular systems allows us to understand the influence of structural, spectroscopic and electronic characteristics of the catalytic precursor on the initiation and catalytic proficiency of the final species. The catalytic performances of the pre-catalysts are determined by the highly electron withdrawing (σ-donation) character of alkoxide ligands, Ot BuF9 being the best. This activity correlates with both the 95 Mo chemical shift and the reduction potential that follows the same trend: Ot BuF9 >Ot BuF6 >Ot BuF3 .

| S-EPMC9313794 | biostudies-literature

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

Project description:The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or β-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

| S-EPMC8835054 | biostudies-literature

Difluoridodioxido(1,10-phenanthroline)molybdenum(VI).

Project description:The title compound, [MoF(2)O(2)(C(12)H(8)N(2))], has non-crystallographic mirror symmetry. The Mo(VI) atom shows a distorted octa-hedral environment, with the phenanthroline N atoms and the two oxide groups forming the equatorial plane and the F atoms occupying the apical positions. Weak C-H⋯O and C-H⋯F hydrogen-bonding contacts and π-π inter-actions [centroid-centroid distance = 3.662 (1) Å] connect the complex mol-ecules into a three-dimensional supra-molecular framework.

| S-EPMC2970040 | biostudies-literature

A Click Chemistry Approach towards Flavin-Cyclodextrin Conjugates-Bioinspired Sulfoxidation Catalysts.

Project description:A click chemistry approach based on the reaction between alkynylflavins and mono(6-azido-6-deoxy)-?-cyclodextrin has proven to be a useful tool for the synthesis of flavin-cyclodextrin conjugates studied as monooxygenase mimics in enantioselective sulfoxidations.

| S-EPMC6331787 | biostudies-literature

Structure and spectroscopy of a bidentate bis-homocitrate dioxo-molybdenum(VI) complex: insights relevant to the structure and properties of the FeMo-cofactor in nitrogenase.

Project description:Direct reaction of potassium molybdate (with natural abundance Mo or enriched with (92)Mo or (100)Mo) with excess hydrolyzed homocitric acid-?-lactone in acidic solution resulted in the isolation of a cis-dioxo bis-homocitrato molybdenum(VI) complex, K(2)[*MoO(2)(R,S-H(2)homocit)(2)]·2H(2)O (1) (*Mo=Mo, 1; (92)Mo, 2; (100)Mo, 3; H(4)homocit=homocitric acid-?-lactone·H(2)O) and K(2)[MoO(2)((18)O-R,S-H(2)homocit)(2)]·2H(2)O (4). The complex has been characterized by elemental analysis, FT-IR, solid and solution (13)C NMR, and single crystal x-ray diffraction analysis. The molybdenum atom in (1) is quasi-octahedrally coordinated by two cis oxo groups and two bidentate homocitrate ligands. The latter coordinates via its ?-alkoxy and ?-carboxy groups, while the ?- and ?-carboxylic acid groups remain uncomplexed, similar to the coordination mode of homocitrate in the Mo-cofactor of nitrogenase. In the IR spectra, the MoO stretching modes near 900 cm(-1) show 2-3 cm(-1) red- and blue-shifts for the (92)Mo-complex (2) and (100)Mo-complex (3) respectively compared with the natural abundance version (1). At lower frequencies, bands at 553 and 540 cm(-1) are assigned to ?(Mo-O) vibrations involving the alkoxide ligand. At higher frequencies, bands in the 1700-1730 cm(-1) region are assigned to stretching modes of protonated carboxylates. In addition, a band at 1675 cm(-1) was observed that may be analogous to a band seen at 1677 cm(-1) in nitrogenase photolysis studies. The solution behavior of (1) in D(2)O was probed with (1)H and (13)C NMR spectra. An obvious dissociation of homocitrate was found, even though bound to the high valent Mo(VI). This suggests the likely lability of coordinated homocitrate in the FeMo-cofactor with its lower valence Mo(IV).

| S-EPMC3596267 | biostudies-literature

Diphenylamido Precursors to Bisalkoxide Molybdenum Olefin Metathesis Catalysts.

Project description:We have found that Mo(NAr)(CHR')(NPh(2))(2) (R' = t-Bu or CMe(2)Ph) and Mo(NAr')(CHCMe(2)Ph)(NPh(2))(2) (Ar = 2,6-i-Pr(2)C(6)H(3); Ar' = 2,6-Me(2)C(6)H(3)) can be prepared through addition of two equivalents of LiNPh(2) to Mo(NR?)(CHR')(OTf)(2)(dme) species (R? = Ar or Ar' dme = 1,2-dimethoxyethane), although yields are low. A high yield route consists of addition of LiNPh(2) to bishexafluro-t-butoxide species. An X-ray structure of Mo(NAr)(CHCMe(2)Ph)(NPh(2))(2) reveals that the two diphenylamido groups are oriented in a manner that allows an 18 electron count to be achieved. The diphenylamido complexes react readily with t-BuOH and (CF(3))(2)MeCOH, but not readily with the sterically demanding biphenol H(2)[Biphen] (Biphen(2-) = 3,3'-Di-t-butyl-5,5',6,6'-tetramethyl-1,1'-Biphenyl-2,2'-diolate). The diphenylamido complexes do react with various 3,3'-disubstituted binaphthols to yield binaphtholate catalysts that can be prepared in situ and employed for a simple asymmetric ring-closing metathesis reaction. In several cases conversions and enantioselectivities were comparable to reactions in which isolated catalysts were employed.

| S-EPMC2585777 | biostudies-literature

Dipyrrolyl precursors to bisalkoxide molybdenum olefin metathesis catalysts.

Project description:Addition of 2 equiv of lithium pyrrolide to Mo(NR)(CHCMe2R')(OTf)2(DME) (OTf = OSO2CF3; R = 2,6-i-Pr2C6H3, 1-adamantyl, or 2,6-Br2-4-MeC6H2; R' = Me or Ph) produces Mo(NR)(CHCMe2R')(NC4H4)2 complexes in good yield. All compounds can be recrystallized readily from toluene or mixtures of pentane and ether and are sensitive to air and moisture. An X-ray structure of a 2,6-diisopropylphenylimido species shows it to be an unsymmetric dimer, {Mo(NAr)(syn-CHCMe2Ph)(eta5-NC4H4)(eta1-NC4H4)}{Mo(NAr)(syn-CHCMe2Ph)(eta1-NC4H4)2}, in which the nitrogen in the eta5-pyrrolyl bound to one Mo behaves as a donor to the other Mo. All complexes are fluxional on the NMR time scale at room temperature, with one symmetric species being observed on the NMR time scale at 50 degrees C in toluene-d8. The dimers react with PMe3 (at Mo) or B(C6F5)3 (at a eta5-NC4H4 nitrogen) to give monomeric products in high yield. They also react rapidly with 2 equiv of monoalcohols (e.g., Me3COH or (CF3)2MeCOH) or 1 equiv of a biphenol or binaphthol to give 2 equiv of pyrrole and bisalkoxide or diolate complexes in approximately 100% yield.

| S-EPMC2528246 | biostudies-literature