Preliminary exploration of clinical factors affecting acute toxicity and quality of life after carbon ion therapy for prostate cancer.
Ontology highlight
ABSTRACT:
SUBMITTER: Zhang Y
PROVIDER: S-EPMC6549341 | biostudies-literature | 2019 Jun
REPOSITORIES: biostudies-literature
Publications
Preliminary exploration of clinical factors affecting acute toxicity and quality of life after carbon ion therapy for prostate cancer.
Zhang Yafang Y Li Ping P Yu Qi Q Wu Shuang S Chen Xue X Zhang Qing Q Fu Shen S
Radiation oncology (London, England) 20190604 1
<h4>Purpose</h4>To assess toxicity and quality-of-life (QOL) after carbon ion radiotherapy (CIRT) at the Shanghai Proton and Heavy Ion Center (SPHIC) and identify clinical factors that correlate with urinary, bowel and sexual function.<h4>Methods</h4>Sixty-four patients with localized prostate cancer admitted from July 2015 to January 2018 underwent CIRT. At baseline and 5 time-points after radiotherapy, we assessed patients' QOL using the 26-item edition of the Expanded Prostate Cancer Index-Co ...[more]
Similar Datasets
Project description:The aim of this study was to prospectively assess 5-year health-related quality of life (HRQOL) of patients treated with carbon ion radiotherapy (C-ion RT) for clinically localized prostate cancer. A total of 417 patients received carbon ion radiotherapy at a total dose of 63-66 Gray-equivalents (GyE) in 20 fractions over 5 weeks, and neoadjuvant and adjuvant androgen deprivation therapy (ADT) were administered for intermediate and high-risk patients. A HRQOL assessment was performed at five time points (immediately before the initiation of C-ion RT, immediately after, and at 12, 36 and 60 months after completion of C-ion RT) using Functional Assessment of Cancer Therapy (FACT) questionnaires. FACT-G and FACT-P scores were significantly decreased; however, the absolute change after 60 months was minimal. The transient decreases in the Trial Outcome Index (TOI) score returned to their baseline levels. Use of ADT, presence of adverse events, and biochemical failure were related to lower scores. Scores of subdomains of FACT instruments indicated characteristic changes. The pattern of HRQOL change after C-ion RT was similar to that of other modalities. Further controlled studies focusing on a HRQOL in patients with prostate cancer are warranted.
| S-EPMC5439371 | biostudies-literature
Project description:ObjectiveThe aim of this study was to select the candidate genes affecting meat quality and preliminarily explore the related molecular mechanisms in the Mashen pig.MethodsThe present study explored genetic factors affecting meat quality in the Mashen pig using RNA sequencing (RNA-Seq). We sequenced the transcriptomes of 180-day-old Mashen and Large White pigs using longissimus dorsi to select differentially expressed genes (DEGs).ResultsThe results indicated that a total of 425 genes were differentially expressed between Mashen and Large White pigs. A gene ontology enrichment analysis revealed that DEGs were mainly enriched for biological processes associated with metabolism and muscle development, while a Kyoto encyclopedia of genes and genomes analysis showed that DEGs mainly participated in signaling pathways associated with amino acid metabolism, fatty acid metabolism, and skeletal muscle differentiation. A MCODE analysis of the protein-protein interaction network indicated that the four identified subsets of genes were mainly associated with translational initiation, skeletal muscle differentiation, amino acid metabolism, and oxidative phosphorylation pathways.ConclusionBased on the analysis results, we selected glutamic-oxaloacetic transaminase 1, malate dehydrogenase 1, pyruvate dehydrogenase 1, pyruvate dehydrogenase kinase 4, and activator protein-1 as candidate genes affecting meat quality in pigs. A discussion of the related molecular mechanisms is provided to offer a theoretical basis for future studies on the improvement of meat quality in pigs.
| S-EPMC6599955 | biostudies-literature
Project description:INTRODUCTION:This study is to evaluate biochemical response, acute toxicity and health-related quality-of-life (QOL) outcomes among prostate cancer patients following stereotactic body radiation therapy (SBRT) in the first Australian CyberKnife facility. METHODS:Forty-five consecutive patients with clinically localised prostate cancer were treated with SBRT using CyberKnife technology and enrolled in this study. Protocol treatment consisted of 36.25 Gy in five fractions. PSA and acute toxicity was assessed at each follow-up visit and QOL was assessed using the European Organisation for Research and Treatment of Cancer (EORTC) Global Health Status (GHS) C30 and PR25 questionnaires and the Karnofsky Performance Status (KPS). Distance of travel for treatment was recorded. RESULTS:The median prostate-specific antigen (PSA) level declined from the initial value of 6.9 ng/mL to 1.5 ng/mL at 6 months and 0.6 ng/mL at 18 months post-treatment. Results were similar in patients who did not receive hormone therapy. Acute grade 1 gastrointestinal (GI) and genitourinary (GU) toxicities were found in 11.1% and 24.4% of patients respectively. Acute grade 2 GI and GU toxicities were found in 2.2% and 11.1% of patients respectively. There were no grade 3 and grade 4 toxicities. Mean urinary symptom score was 14.8 at baseline, 17.2 at 6 weeks and 18.3 at 6 months (P > 0.05). Mean bowel symptom score was 2.7 at baseline, 4.2 at 6 weeks and 6.3 at 6 months (P > 0.05). The mean GHS score improved from 81.3 at baseline to 82.4 at 6 weeks, and was 75.6 at 6 months (P > 0.05, not significant). Compared to baseline KPS, there was a significant mean decrease from baseline of 96.7 to 93.3 at the 6-week follow-up (P = 0.0043), which then recovered to 94.3 at the 6-month follow-up (P = 0.1387). CONCLUSIONS:Early results show promising PSA response. Acute toxicity seemed comparable to results from conventionally fractionated radiotherapy and to international prostate SBRT studies. EORTC PR25 and C30 scores did not reveal any significant change from baseline, and although there was a decrease in KPS, the absolute decrease was small.
| S-EPMC5587659 | biostudies-literature
Project description:BackgroundWe aimed at determining the safety and feasibility of spot-scanning carbon ion radiotherapy (CIRT) for patients with localized prostate cancer.MethodsWe enrolled 118 patients with localized prostate cancer who underwent treatment with spot-scanning CIRT at the Shanghai Proton and Heavy Ion Center (SPHIC) from January 2016 to December 2020. The dose was gradually increased from relative biological effectiveness (RBE)-weighted dose (DRBE) = 59.2-65.6 Gy in 16 fractions. The primary endpoint was the occurrence of acute and late toxicities, while the secondary endpoints were biochemical relapse-free survival (bRFS), distant metastasis-free survival (DMFS), prostate cancer-specific survival (PCSS), and overall survival (OS).ResultsThe median follow-up time was 30.2 months (4.8-62.7 months). Acute grade 1 and 2 genitourinary (GU) toxicities were 15.3% and 18.6%, while acute grade 1 and 2 gastrointestinal (GI) toxicities were 2.5% and 0%, respectively. Late grade 1 and 2 GU toxicities were 4.2% and 1.7%, respectively. No late GI toxicity was observed. Moreover, there were no cases of severe acute or late toxicity (≥ grade 3). No significant association were observed between the factors and the acute GU toxicities, except for clinical target volume (CTV) (p = 0.031) on multivariate analysis. The 2-year bRFS, DMFS, PCSS, and OS were 100%, 100%, 100%, and 98.8%, respectively.ConclusionThe 2-year outcomes were encouraging, providing additional and useful information on the feasibility and safety of spot-scanning CIRT for treating prostate cancer. Thus, we recommend long-term follow-up and prospective multicentered studies to reinforce the role of CIRT in the management of localized prostate cancer.
| S-EPMC8881099 | biostudies-literature
Project description:This study aimed to first elucidate prostate-specific antigen (PSA) kinetics in prostate cancer patients treated with carbon ion radiotherapy (CIRT). From 2010 to 2015, 131 patients with prostate adenocarcinoma treated with CIRT (57.6 Gy relative biological effectiveness (RBE) in 16 fractions) alone were recruited. PSA was measured at 1, 2, 3, 6, 9, 12, 15, 18, 21, 24, 30, 36, 42, 48, 54, and 60 months post-CIRT. PSA bounce was defined as PSA increase over a cutoff followed by spontaneous decrease to or below the pre-bounce nadir. PSA failure was determined using the Phoenix criteria (nadir + 2.0 ng/mL). As a result, non-failure-associated temporary increase in PSA exhibited two distinct patterns, namely a classical bounce and a surge at one month. PSA bounce of ³0.2 ng/mL was observed in 55.7% of the patients. Bounce amplitude was <2.0 ng/mL in 97.6% of cases. Bounce occurred significantly earlier than PSA failure. Younger age was a significant predictor of bounce occurrence. Bounce positivity was a significant predictor of favorable 5-year PSA failure-free survival. Meanwhile, a PSA surge of ³0.2 ng/mL was observed in 67.9% of patients. Surge amplitude was significantly larger than bounce amplitude. Larger prostate volume was a significant predictor of PSA surge occurrence. PSA surge positivity did not significantly predict PSA failure. In summary, PSA bounce was distinguishable from PSA failure with regard to timing of occurrence and amplitude (earlier and lower for bounce, respectively). These data are useful for post-CIRT surveillance of prostate cancer patients.
| S-EPMC7139713 | biostudies-literature
Project description:To report quality of life (QOL)/toxicity in men treated with proton beam therapy for localized prostate cancer and to compare outcomes between passively scattered proton therapy (PSPT) and spot-scanning proton therapy (SSPT).Men with localized prostate cancer enrolled on a prospective QOL protocol with a minimum of 2 years' follow-up were reviewed. Comparative groups were defined by technique (PSPT vs SSPT). Patients completed Expanded Prostate Cancer Index Composite questionnaires at baseline and every 3-6 months after proton beam therapy. Clinically meaningful differences in QOL were defined as ?0.5 × baseline standard deviation. The cumulative incidence of modified Radiation Therapy Oncology Group grade ?2 gastrointestinal (GI) or genitourinary (GU) toxicity and argon plasma coagulation were determined by the Kaplan-Meier method.A total of 226 men received PSPT, and 65 received SSPT. Both PSPT and SSPT resulted in statistically significant changes in sexual, urinary, and bowel Expanded Prostate Cancer Index Composite summary scores. Only bowel summary, function, and bother resulted in clinically meaningful decrements beyond treatment completion. The decrement in bowel QOL persisted through 24-month follow-up. Cumulative grade ?2 GU and GI toxicity at 24 months were 13.4% and 9.6%, respectively. There was 1 grade 3 GI toxicity (PSPT group) and no other grade ?3 GI or GU toxicity. Argon plasma coagulation application was infrequent (PSPT 4.4% vs SSPT 1.5%; P=.21). No statistically significant differences were appreciated between PSPT and SSPT regarding toxicity or QOL.Both PSPT and SSPT confer low rates of grade ?2 GI or GU toxicity, with preservation of meaningful sexual and urinary QOL at 24 months. A modest, yet clinically meaningful, decrement in bowel QOL was seen throughout follow-up. No toxicity or QOL differences between PSPT and SSPT were identified. Long-term comparative results in a larger patient cohort are warranted.
| S-EPMC4086944 | biostudies-literature
Project description:Knowledge of experiences from prostate cancer is sparse in a longitudinal perspective. From a nursing perspective, results from combined qualitative and quantitative studies are lacking however would present the broadest knowledge base for best practice. Present descriptions of medical-physical symptoms such as urinary, bowel and sexual dysfunction from quantitative inquiries need be complemented with qualitative results. Such knowledge is essential in relation to treatment and communication with patients over the years and not only shortly after surgery.A longitudinal study was formatted to investigate general and specific health quality and sense of coherence quantitative alterations over three years. A general health quality module (EORTC QLC-C30) and a disease-specific module (EORTC PR-25) were applied for the longitudinal study together with the Orientation to life questionnaire (SOC), measuring a persons' sense of coherence. In order to strengthen reliability and compensate for low participation we used the Directed content analysis for interviewing and analysis. The method allows using findings from earlier research when interviewing along with detecting new areas. Twenty-one men were followed over three years and six of them, in the third year, accepted to be interviewed.We found high quality of life ratings and extended the study with follow-up interviews in year three, to investigate whether questionnaire results were in line with interview findings. We found high life quality and functioning ratings that were in line with qualitative descriptions. Interview analysis showed retrieval of life as lived before, yet in a different way, the men never forgot the diagnosis event, had a unique illness history worth hearing, and had come to terms with most treatment-related shortcomings. Sense of coherence ratings were medium to high and confirmed stability over time in comprehensibility, manageability and meaningfulness after prostate cancer treatment.Over the years, the men's negative experiences from shifted into 'a good life' though in a different way than before. The interpretation is supported in the study by quantitative results showing a high degree of functioning. The men's sense of coherence seamed to support their handling of life three years after prostate cancer treatment.
| S-EPMC3626890 | biostudies-other
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:Carbon-ion radiotherapy (CIRT) represents a definitive treatment for inoperable bone and soft tissue sarcoma (BSTS). This prospective study analyzed 61 patients with inoperable BSTS who were treated with CIRT to evaluate QOL, functional outcomes, and predictive factors in patients with inoperable BSTS treated with definitive CIRT. The Musculoskeletal Tumor Society (MSTS) scoring system and the Short Form (SF)-8 questionnaire were completed before and at 1, 3, 6, 12, and 24 months after CIRT. The median follow-up period was 38 months. The main site of primary disease was the pelvis (70.5%), and the most common pathologic diagnosis was chordoma (45.9%). The 3-year overall survival and local control rates were 87.8% and 83.8%, respectively. The MSTS score and physical component score (PCS) of SF-8 did not change significantly between the baseline and subsequent values. The mental component score of SF-8 significantly improved after CIRT. Multivariate analysis showed that the normalized MSTS and normalized PCS of SF-8 at the final follow-up were significantly affected by performance status at diagnosis and sex. CIRT showed clinical efficacy, preserving the physical component of QOL and functional outcomes and improving the mental component of QOL, suggesting its potential value for the treatment of patients with inoperable BSTS.
| S-EPMC8199366 | biostudies-literature
Project description:Based on previous research on the acute toxicity of major ions (Na+ , K+ , Ca2+ , Mg2+ , Cl- , SO42- , and HCO3- /CO32- ) to Ceriodaphnia dubia, a mathematical model was developed for predicting the median lethal concentration (LC50) for any ion mixture, excepting those dominated by K-specific toxicity. One component of the model describes a mechanism of general ion toxicity to which all ions contribute and predicts LC50s as a function of osmolarity and Ca activity. The other component describes Mg/Ca-specific toxicity to apply when such toxicity exceeds the general ion toxicity and predicts LC50s as a function of Mg and Ca activities. This model not only tracks well the observed LC50s from past research used for model development but also successfully predicts LC50s from new toxicity tests on synthetic mixtures of ions emulating chemistries of various ion-enriched effluents and receiving waters. It also performs better than a previously published model for major ion toxicity. Because of the complexities of estimating chemical activities and osmolarity, a simplified model based directly on ion concentrations was also developed and found to provide useful predictions. Environ Toxicol Chem 2018;37:247-259. Published 2017 Wiley Periodicals Inc. on behalf of SETAC. This article is a US government work and, as such, is in the public domain in the United States of America.
| S-EPMC5747266 | biostudies-literature