Dataset Information

GATAD1 gene amplification promotes glioma malignancy by directly regulating CCND1 transcription.

ABSTRACT:

Background

The GATAD1 gene overexpression induced by GATAD1 amplification upregulation is detected in different human tumors. To date, the relationship between GATAD1 amplification and glioma oncogenesis and malignancy is still unknown.

Methods

GATAD1 gene amplification and expression were analyzed in 187 gliomas using qPCR and immunostaining. The relation of GATAD1 to patients' prognoses was assessed via the Kaplan-Meier method. The MTT and orthotopic tumor transplantation assays were used to identify the function of GATAD1 in glioma proliferation. cDNA microarray, ChIP qPCR, EMSA and 3C were used to screen the downstream mechanism of GATAD1 regulating glioma proliferation.

Results

Our results indicated that GATAD1 gene amplification and GATAD1 gene expression are novel independent diagnosis biomarkers to indicate poor outcome of glioma patients. GATAD1 knockdown can remarkably suppress GBM cell proliferation both in vitro and in vivo. GATAD1 could promote CCND1 gene transcription by inducing long range chromatin architectural interaction on the CCND1 promoter. Then GATAD1 sequentially accelerates GBM cell cycle transition and proliferation via regulating CCND1.

Conclusions

We identify GATAD1 as a novel potential diagnosis biomarker and promising prognosis predictor in glioma patients. Functionally, we confirm GATAD1 as an epigenetic chromatin topological regulator that promotes glioma proliferation by targeting CCND1.

SUBMITTER: Zhang S

PROVIDER: S-EPMC6718743 | biostudies-literature | 2019 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

GATAD1 gene amplification promotes glioma malignancy by directly regulating CCND1 transcription.

Zhang Shanshan S Gao Min M Yu Lin L

Cancer medicine 20190708 11

<h4>Background</h4>The GATAD1 gene overexpression induced by GATAD1 amplification upregulation is detected in different human tumors. To date, the relationship between GATAD1 amplification and glioma oncogenesis and malignancy is still unknown.<h4>Methods</h4>GATAD1 gene amplification and expression were analyzed in 187 gliomas using qPCR and immunostaining. The relation of GATAD1 to patients' prognoses was assessed via the Kaplan-Meier method. The MTT and orthotopic tumor transplantation assays ...[more]

PMID: 31286678

Similar Datasets

Project description:Circular RNAs are a subgroup of non-coding RNAs and generated by a mammalian genome. Herein, the expression and function of circular RNA circ-TTBK2 were investigated in human glioma cells.Fluorescence in situ hybridization and quantitative real-time PCR were conducted to profile the cell distribution and expression of circ-TTBK2 and microRNA-217 (miR-217) in glioma tissues and cells. Immunohistochemical and western blot were used to determine the expression of HNF1? and Derlin-1 in glioma tissues and cells. Stable knockdown of circ-TTBK2 or overexpression of miR-217 glioma cell lines (U87 and U251) were established to explore the function of circ-TTBK2 and miR-217 in glioma cells. Further, luciferase reports and RNA immunoprecipitation were used to investigate the correlation between circ-TTBK2 and miR-217. Cell Counting Kit-8, transwell assays, and flow cytometry were used to investigate circ-TTBK2 and miR-217 function including cell proliferation, migration and invasion, and apoptosis, respectively. ChIP assays were used to ascertain the correlations between HNF1? and Derlin-1.We found that circ-TTBK2 was upregulated in glioma tissues and cell lines, while linear TTBK2 was not dysregulated in glioma tissues and cells. Enhanced expression of circ-TTBK2 promoted cell proliferation, migration, and invasion, while inhibited apoptosis. MiR-217 was downregulated in glioma tissues and cell lines. We also found that circ-TTBK2, but not linear TTBK2, acted as miR-217 sponge in a sequence-specific manner. In addition, upregulated circ-TTBK2 decreased miR-217 expression and there was a reciprocal negative feedback between them in an Argonaute2-dependent manner. Moreover, reintroduction of miR-217 significantly reversed circ-TTBK2-mediated promotion of glioma progression. HNF1? was a direct target of miR-217, and played oncogenic role in glioma cells. Remarkably, circ-TTBK2 knockdown combined with miR-217 overexpression led to tumor regression in vivo.These results demonstrated a novel role circ-TTBK2 in the glioma progression.

Project description:BackgroundSome recent studies have reported the role of circular RNAs (circRNAs) in modulating the tumorigenesis of human malignancies. Nevertheless, the expression characteristics, biological functions, and regulatory mechanism of circ_0000189 in glioma are unclear.MethodsQuantitative real-time polymerase chain reaction (qRT-PCR) was utilized to detect the expression levels of circ_0000189, miR-192-5p, and ZEB2 mRNA in glioma tissues and cells. The association between the expression of circ_0000189 and the clinicopathological indicators and the features of magnetic resonance imaging (MRI) images of glioma patients were analyzed. Western blot was utilized to evaluate ZEB2 expression and epithelial-mesenchymal transition (EMT-)-related proteins (E-cadherin, N-cadherin, as well as Vimentin) in glioma cells. Cell proliferation was assessed employing cell counting kit-8 (CCK-8) and EdU experiments. Flow cytometry was used to detect the apoptotic rate of the cells. Cell migration and invasion were accessed employing Transwell assay. Moreover, dual luciferase reporter gene assay and RNA immunoprecipitation assay were employed to investigate the targeting relationship between miR-192-5p and circ_0000189, miR-192-5p, and ZEB2. Subcutaneous tumorigenesis experiment and lung metastasis experiment in nude mice were conducted to verify the regulatory function of circ_0000189 on the proliferation and metastasis of glioma cells in vivo.Resultscirc_0000189 was markedly overexpressed in glioma tissues and cell lines. Its high expression was associated with poor clinical pathological indicators and adverse MRI signs. Gain-of-function experiments and loss-of-function experiments confirmed that circ_0000189 overexpression facilitated the proliferation and migration, as well as invasion of glioma cells, and suppressed apoptosis, and facilitated epithelial-mesenchymal transition (EMT) process. Compared to the control group, knocking down circ_0000189 suppressed the malignant phenotypes of glioma cells both in vivo and in vitro. Working as a competitive endogenous RNA, circ_0000189 directly targeted miR-192-5p, and repressed its expression, and circ_0000189 positively modulated ZEB2 expression indirectly via repressing miR-192-5p.Conclusioncirc_0000189 facilitates the progression of glioma by modulating miR-192-5p/ZEB2 axis.

Project description:BackgroundGlioma is the most common and aggressive tumor in the adult brain. Recent studies have indicated that Zinc finger DHHC-type palmitoyltransferases (ZDHHCs) play vital roles in regulating the progression of glioma. ZDHHC15, a member of the ZDHHCs family, participates in various physiological activities in the brain. However, the biological functions and related mechanisms of ZDHHC15 in glioma remain poorly understood.MethodsData from multiple glioma-associated datasets were used to investigate the expression profiles and potential biological functions of ZDHHC15 in glioma. Expression of ZDHHC15 and its association with clinicopathological characteristics in glioma were validated by quantitative reverse transcription PCR (RT-qPCR) and immunohistochemical experiments. GO enrichment analysis, KEGG analysis, GSEA analysis, CCK-8, EdU, transwell, and western blotting assays were performed to confirm the functions and mechanism of ZDHHC15 in glioma. Moreover, we performed Kaplan-Meier analysis and Cox progression analysis to explore the prognostic significance of ZDHHC15 in glioma patients.ResultsZDHHC15 expression was significantly up-regulated in glioma and positively associated with malignant phenotypes. Results from the GO and KEGG enrichment analysis revealed that ZDHHC15 was involved in regulating cell cycle and migration. Knockdown of ZDHHC15 inhibited glioma cell proliferation and migration, while overexpression of ZDHHC15 presented opposite effects on glioma cells. Besides, results from GSEA analysis suggested that ZDHHC15 was enriched in STAT3 signaling pathway. Knockdown or overexpression of ZDHHC15 indeed affected the activation of STAT3 signaling pathway. Additionally, we identified ZDHHC15 as an independent prognostic biomarker in glioma, and higher expression of ZDHHC15 predicted a poorer prognosis in glioma patients.ConclusionOur findings suggest that ZDHHC15 promotes glioma malignancy and can serve as a novel prognostic biomarker for glioma patients. Targeting ZDHHC15 may be a promising therapeutic strategy for glioma.

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.

Dataset Information

GATAD1 gene amplification promotes glioma malignancy by directly regulating CCND1 transcription.

Background

Methods

Results

Conclusions

Publications

GATAD1 gene amplification promotes glioma malignancy by directly regulating CCND1 transcription.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets