Project description:Circular RNAs are a subgroup of non-coding RNAs and generated by a mammalian genome. Herein, the expression and function of circular RNA circ-TTBK2 were investigated in human glioma cells.Fluorescence in situ hybridization and quantitative real-time PCR were conducted to profile the cell distribution and expression of circ-TTBK2 and microRNA-217 (miR-217) in glioma tissues and cells. Immunohistochemical and western blot were used to determine the expression of HNF1? and Derlin-1 in glioma tissues and cells. Stable knockdown of circ-TTBK2 or overexpression of miR-217 glioma cell lines (U87 and U251) were established to explore the function of circ-TTBK2 and miR-217 in glioma cells. Further, luciferase reports and RNA immunoprecipitation were used to investigate the correlation between circ-TTBK2 and miR-217. Cell Counting Kit-8, transwell assays, and flow cytometry were used to investigate circ-TTBK2 and miR-217 function including cell proliferation, migration and invasion, and apoptosis, respectively. ChIP assays were used to ascertain the correlations between HNF1? and Derlin-1.We found that circ-TTBK2 was upregulated in glioma tissues and cell lines, while linear TTBK2 was not dysregulated in glioma tissues and cells. Enhanced expression of circ-TTBK2 promoted cell proliferation, migration, and invasion, while inhibited apoptosis. MiR-217 was downregulated in glioma tissues and cell lines. We also found that circ-TTBK2, but not linear TTBK2, acted as miR-217 sponge in a sequence-specific manner. In addition, upregulated circ-TTBK2 decreased miR-217 expression and there was a reciprocal negative feedback between them in an Argonaute2-dependent manner. Moreover, reintroduction of miR-217 significantly reversed circ-TTBK2-mediated promotion of glioma progression. HNF1? was a direct target of miR-217, and played oncogenic role in glioma cells. Remarkably, circ-TTBK2 knockdown combined with miR-217 overexpression led to tumor regression in vivo.These results demonstrated a novel role circ-TTBK2 in the glioma progression.

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.

Dataset Information

GATAD1 gene amplification promotes glioma malignancy by directly regulating CCND1 transcription.

Background

Methods

Results

Conclusions

Publications

GATAD1 gene amplification promotes glioma malignancy by directly regulating CCND1 transcription.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure