Dataset Information

Airway epithelial specific deletion of Jun-N-terminal kinase 1 attenuates pulmonary fibrosis in two independent mouse models.

ABSTRACT: The stress-induced kinase, c-Jun-N-terminal kinase 1 (JNK1) has previously been implicated in the pathogenesis of lung fibrosis. However, the exact cell type(s) wherein JNK1 exerts its pro-fibrotic role(s) remained enigmatic. Herein we demonstrate prominent activation of JNK in bronchial epithelia using the mouse models of bleomycin- or AdTGF?1-induced fibrosis. Furthermore, in lung tissues of patients with idiopathic pulmonary fibrosis (IPF), active JNK was observed in various regions including type I and type II pneumocytes and fibroblasts. No JNK activity was observed in adjacent normal tissue or in normal control tissue. To address the role of epithelial JNK1, we ablated Jnk1 form bronchiolar and alveolar type II epithelial cells using CCSP-directed Cre recombinase-mediated ablation of LoxP-flanked Jnk1 alleles. Our results demonstrate that ablation of Jnk1 from airway epithelia resulted in a strong protection from bleomycin- or adenovirus expressing active transforming growth factor beta-1 (AdTGF?1)-induced fibrosis. Ablation of the Jnk1 allele at a time when collagen increases were already present showed a reversal of existing increases in collagen content. Epithelial Jnk1 ablation resulted in attenuation of mesenchymal genes and proteins in lung tissue and preserved expression of epithelial genes. Collectively, these data suggest that epithelial JNK1 contributes to the pathogenesis of pulmonary fibrosis. Given the presence of active JNK in lungs from patients with IPF, targeting JNK1 in airway epithelia may represent a potential treatment strategy to combat this devastating disease.

SUBMITTER: van der Velden JL

PROVIDER: S-EPMC6959564 | biostudies-literature | 2020

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Airway epithelial specific deletion of Jun-N-terminal kinase 1 attenuates pulmonary fibrosis in two independent mouse models.

van der Velden Jos L JL Alcorn John F JF Chapman David G DG Lundblad Lennart K A LKA Irvin Charles G CG Davis Roger J RJ Butnor Kelly K Janssen-Heininger Yvonne M W YMW

PloS one 20200114 1

The stress-induced kinase, c-Jun-N-terminal kinase 1 (JNK1) has previously been implicated in the pathogenesis of lung fibrosis. However, the exact cell type(s) wherein JNK1 exerts its pro-fibrotic role(s) remained enigmatic. Herein we demonstrate prominent activation of JNK in bronchial epithelia using the mouse models of bleomycin- or AdTGFβ1-induced fibrosis. Furthermore, in lung tissues of patients with idiopathic pulmonary fibrosis (IPF), active JNK was observed in various regions including ...[more]

PMID: 31935227

Similar Datasets

Project description:BackgroundIdiopathic pulmonary fibrosis (IPF) is a progressive and fatal disease with no effective treatment. The epithelial-mesenchymal transition (EMT) is a critical stage during the development of fibrosis. To assess the effect of sulforaphane (SFN) on the EMT and fibrosis using an in vitro transforming growth factor (TGF)-β1-induced model and an in vivo bleomycin (BLM)-induced model.MethodsIn vitro studies, cell viability, and cytotoxicity were measured using a Cell Counting Kit-8. The functional TGF-β1-induced EMT and fibrosis were assessed using western blotting and a quantitative real-time polymerase chain reaction. The lungs were analyzed histopathologically in vivo using hematoxylin and eosin and Masson's trichrome staining. The BLM-induced fibrosis was characterized by western blotting and immunohistochemical analyses for fibronectin, TGF-β1, E-cadherin (E-cad), and α-smooth muscle actin (SMA) in lung tissues.ResultsSFN reversed mesenchymal-like changes induced by TGF-β1 and restored cells to their epithelial-like morphology. The results confirmed that the expression of the epithelial marker, E-cadherin, increased after SFN treatment, while expression of the mesenchymal markers, N-cadherin, vimentin, and α-SMA decreased in A549 cells after SFN treatment. In addition, SFN inhibited TGF-β1-induced mRNA expression of the EMT-related transcription factors, Slug, Snail, and Twist. The SFN treatment attenuated TGF-β1-induced expression of fibrosis-related proteins, such as fibronection, collagen I, collagen IV, and α-SMA in MRC-5 cells. Furthermore, SFN reduced the TGF-β1-induced phosphorylation of SMAD2/3 protein in A549 cells and MRC-5 cells. BLM induced fibrosis in mouse lungs that was also attenuated by SFN treatment, and SFN treatment decreased BLM-induced fibronectin expression, TGF-β1 expression, and the levels of collagen I in the lungs of mice.ConclusionsSFN showed a significant anti-fibrotic effect in TGF-β-treated cell lines and BLM-induced fibrosis in mice. These findings showed that SFN has anti-fibrotic activity that may be considered in the treatment of IPF.

Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.

Dataset Information

Airway epithelial specific deletion of Jun-N-terminal kinase 1 attenuates pulmonary fibrosis in two independent mouse models.

Publications

Airway epithelial specific deletion of Jun-N-terminal kinase 1 attenuates pulmonary fibrosis in two independent mouse models.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets