Unknown

Dataset Information

0

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.


ABSTRACT: Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

SUBMITTER: Wang ZF 

PROVIDER: S-EPMC7026657 | biostudies-literature | 2020 Feb

REPOSITORIES: biostudies-literature

altmetric image

Publications

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Wang Zi-Fu ZF   Li Ming-Hao MH   Chu I-Te IT   Winnerdy Fernaldo R FR   Phan Anh T AT   Chang Ta-Chau TC  

Nucleic acids research 20200201 3


Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structur  ...[more]

Similar Datasets

| S-EPMC10045866 | biostudies-literature
| S-EPMC10448861 | biostudies-literature
| S-EPMC11252454 | biostudies-literature
| S-EPMC6317262 | biostudies-literature
| S-EPMC7413387 | biostudies-literature
| S-EPMC4693632 | biostudies-literature
| S-EPMC3169596 | biostudies-literature
2020-06-23 | GSE149502 | GEO
| S-EPMC3672139 | biostudies-literature
| S-EPMC3985701 | biostudies-literature