Dataset Information

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

ABSTRACT: Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

SUBMITTER: Wang ZF

PROVIDER: S-EPMC7026657 | biostudies-literature | 2020 Feb

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Wang Zi-Fu ZF Li Ming-Hao MH Chu I-Te IT Winnerdy Fernaldo R FR Phan Anh T AT Chang Ta-Chau TC

Nucleic acids research 20200201 3

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structur ...[more]

PMID: 31912153

Similar Datasets

Project description:DNA sequences with the potential to form secondary structures such as i-motifs (iMs) and G-quadruplexes (G4s) are abundant in the promoters of several oncogenes and, in some instances, are known to regulate gene expression. Recently, iM-forming DNA strands have also been employed as functional units in nanodevices, ranging from drug delivery systems to nanocircuitry. To understand both the mechanism of gene regulation by iMs and how to use them more efficiently in nanotechnological applications, it is essential to have a thorough knowledge of factors that govern their conformational states and stabilities. Most of the prior work to characterize the conformational dynamics of iMs have been done with iM-forming synthetic constructs like tandem (CCT)n repeats and in standard dilute buffer systems. Here, we present a systematic study on the consequences of epigenetic modifications, molecular crowding, and degree of hydration on the stabilities of an iM-forming sequence from the promoter of the c-myc gene. Our results indicate that 5-hydroxymethylation of cytosines destabilized the iMs against thermal and pH-dependent melting; contrarily, 5-methylcytosine modification stabilized the iMs. Under molecular crowding conditions (PEG-300, 40% w/v), the thermal stability of iMs increased by ∼10 °C, and the pKa was raised from 6.1 ± 0.1 to 7.0 ± 0.1. Lastly, the iM's stability at varying degrees of hydration in 1,2-dimethoxyethane, 2-methoxyethanol, ethylene glycol, 1,3-propanediol, and glycerol cosolvents indicated that the iMs are stabilized by dehydration because of the release of water molecules when folded. Our results highlight the importance of considering the effects of epigenetic modifications, molecular crowding, and the degree of hydration on iM structural dynamics. For example, the incorporation of 5-methylycytosines and 5-hydroxymethlycytosines in iMs could be useful for fine-tuning the pH- or temperature-dependent folding/unfolding of an iM. Variations in the degree of hydration of iMs may also provide an additional control of the folded/unfolded state of iMs without having to change the pH of the surrounding matrix.

Dataset Information

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Publications

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets