Dataset Information

Hsa_circ_0044226 knockdown attenuates progression of pulmonary fibrosis by inhibiting CDC27.

ABSTRACT: Idiopathic pulmonary fibrosis (IPF) is a chronic and progressive lung disorder. Here, we performed a bioinformatics analysis using the GSE102660 dataset from the Gene Expression Omnibus database to identify differentially expressed circRNAs (DEcircRNAs) in tissues from IPF patients and healthy controls. The results identified 45 DEcircRNAs, among which expression of hsa_circ_0044226 was markedly higher in lung tissues from IPF patients than from healthy controls. Knocking down hsa_circ_0044226 expression using a targeted shRNA inhibited TGF-?1-induced fibrosis in RLE-6TN cells and in a bleomycin-induced mouse model of IPA. The diminished TGF-?1-induced fibrosis was associated with upregulated expression of E-cadherin and downregulated expression of ?-SMA, collagen III and fibronectin 1, as well as with reduced expression of CDC27, suggesting inhibition of epithelial-to-mesenchymal transition (EMT). All of those effects were reversed by overexpression of CDC27. This suggests CDC27 overexpression abolishes the antifibrotic effect of hsa_circ_0044226 knockdown through activation of EMT. Furthermore, hsa_circ_0044226 knockdown decreased the expression of CDC27 in BLM-induced pulmonary fibrosis mouse model. Collectively then, these findings indicate that downregulation of hsa_circ_0044226 attenuates pulmonary fibrosis in vitro and in vivo by inhibiting CDC27, which in turn suppresses EMT. This suggests hsa_circ_0044226 may be a useful therapeutic target for the treatment of IPF.

SUBMITTER: Qi F

PROVIDER: S-EPMC7425454 | biostudies-literature | 2020 Jul

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Hsa_circ_0044226 knockdown attenuates progression of pulmonary fibrosis by inhibiting CDC27.

Qi Fei F Li Yong Y Yang Xue X Wu Yanping Y Lin Lianjun L Liu Xinmin X

Aging 20200724 14

Idiopathic pulmonary fibrosis (IPF) is a chronic and progressive lung disorder. Here, we performed a bioinformatics analysis using the GSE102660 dataset from the Gene Expression Omnibus database to identify differentially expressed circRNAs (DEcircRNAs) in tissues from IPF patients and healthy controls. The results identified 45 DEcircRNAs, among which expression of hsa_circ_0044226 was markedly higher in lung tissues from IPF patients than from healthy controls. Knocking down hsa_circ_0044226 e ...[more]

PMID: 32710728

Similar Datasets

Project description:BackgroundIdiopathic pulmonary fibrosis (IPF) is a progressive and fatal disease with no effective treatment. The epithelial-mesenchymal transition (EMT) is a critical stage during the development of fibrosis. To assess the effect of sulforaphane (SFN) on the EMT and fibrosis using an in vitro transforming growth factor (TGF)-β1-induced model and an in vivo bleomycin (BLM)-induced model.MethodsIn vitro studies, cell viability, and cytotoxicity were measured using a Cell Counting Kit-8. The functional TGF-β1-induced EMT and fibrosis were assessed using western blotting and a quantitative real-time polymerase chain reaction. The lungs were analyzed histopathologically in vivo using hematoxylin and eosin and Masson's trichrome staining. The BLM-induced fibrosis was characterized by western blotting and immunohistochemical analyses for fibronectin, TGF-β1, E-cadherin (E-cad), and α-smooth muscle actin (SMA) in lung tissues.ResultsSFN reversed mesenchymal-like changes induced by TGF-β1 and restored cells to their epithelial-like morphology. The results confirmed that the expression of the epithelial marker, E-cadherin, increased after SFN treatment, while expression of the mesenchymal markers, N-cadherin, vimentin, and α-SMA decreased in A549 cells after SFN treatment. In addition, SFN inhibited TGF-β1-induced mRNA expression of the EMT-related transcription factors, Slug, Snail, and Twist. The SFN treatment attenuated TGF-β1-induced expression of fibrosis-related proteins, such as fibronection, collagen I, collagen IV, and α-SMA in MRC-5 cells. Furthermore, SFN reduced the TGF-β1-induced phosphorylation of SMAD2/3 protein in A549 cells and MRC-5 cells. BLM induced fibrosis in mouse lungs that was also attenuated by SFN treatment, and SFN treatment decreased BLM-induced fibronectin expression, TGF-β1 expression, and the levels of collagen I in the lungs of mice.ConclusionsSFN showed a significant anti-fibrotic effect in TGF-β-treated cell lines and BLM-induced fibrosis in mice. These findings showed that SFN has anti-fibrotic activity that may be considered in the treatment of IPF.

Project description:Silicosis is a fatal occupational lung disease which currently has no effective treatment. Dihydroquercetin (DHQ) is a flavonoid compound known for its anti-inflammatory, anti-oxidant and anti-cancer bioactivity. However, whether DHQ protects against silica-induced lung fibrosis remains unknown. Therefore, we aimed to investigate the effect of DHQ on silica-induced lung fibrosis and the underlying molecular mechanism in vivo and in vitro. Our results demonstrated that DHQ treatment markedly attenuated SiO2-induced inflammation and fibrosis degree of lung tissues in the C57BL/6 mice. Additionally, experiments in vitro also confirmed that conditioned medium from DHQ-treated human bronchial epithelial (HBE) cells significantly decreased expression of fibrosis markers of human fetal lung fibroblast cells (MRC-5), such as α-SMA, collagen1 and fibronectin. Interestingly, HBE cells treated by DHQ showed few morphological features of ferroptosis compared with SiO2-treated cells. Furthermore, DHQ treatment remarkably inhibited ferroptosis in activated HBE cells by decreasing the accumulation of iron and lipid peroxidation products, and increasing levels of glutathione (GSH) and glutathione peroxidase 4 (GPX4), whereas stimulation of ferroptosis by specific inducer erastin deeply impaired anti-fibrosis effect of DHQ in vitro. More importantly, our results showed that DHQ also evidently suppressed ferritinophagy by down-regulation of microtubule-associated protein 1A/1B-light chain 3 (LC3), and up-regulation of ferritin heavy chain 1 (FTH1), nuclear receptor co-activator 4 (NCOA4) in activated HBE cells. Nevertheless, activation of ferritinophagy by specific inducer rapamycin (Rapa) evidently blocked DHQ-inhibited HBE cells ferritinophagy and anti-fibrosis effect of DHQ. Overall, our research revealed that inhibition of ferritinophagy-mediated HBE cells ferroptosis was responsible for DHQ to ameliorate SiO2-induced lung fibrosis, which provided a preliminary theoretical basis for the clinical application of DHQ in the treatment of silicosis.

Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.

Dataset Information

Hsa_circ_0044226 knockdown attenuates progression of pulmonary fibrosis by inhibiting CDC27.

Publications

Hsa_circ_0044226 knockdown attenuates progression of pulmonary fibrosis by inhibiting CDC27.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets