Dataset Information

BuShen HuoXue Decoction Promotes Decidual Stromal Cell Proliferation via the PI3K/AKT Pathway in Unexplained Recurrent Spontaneous Abortion.

ABSTRACT: BuShen HuoXue decoction (BSHXD) has been used to treat patients with unexplained recurrent spontaneous abortion (URSA). However, the chemical compounds and mechanism by which BSHXD exerts its therapeutic and systemic effects to promote the proliferation of decidual stromal cells (DSCs) has not been elucidated. This work sought to elucidate the cellular and molecular mechanism of BSHXD in terms of inflammatory factors IL-17A in DSCs in vitro because of the critical roles of inflammation, apoptosis, and immunity in the development and progression of pregnancy loss. Twelve migratory chemical compounds from BSHXD extract were qualitatively analyzed by high-performance liquid chromatography (HPLC). DSCs were collected from normal early pregnancy (NEP) and URSA to determine whether BSHXD affects IL-17A/IL17RA via the PI3K/AKT pathway. Abnormal apoptosis and activated p-AKT were observed in URSA DSCs. RhIL-17?A, LY294002 (a PI3K pathway inhibitor), and BSHXD were individually or simultaneously administered in NEP DSCs, suggesting that BSHXD restored cell proliferation without excessive stimulation and IL-17A promotes proliferation via the PI3K/AKT pathway. Using the same intervention in URSA DSCs, qRT-PCR measured the upregulated mRNA levels of IL-17?A/IL-17RA, PI3K, AKT, p-AKT, PTEN, Bcl-2, and Bcl-xL and downregulated mRNA levels of BAD and ACT1 after treatment with BSHXD. We demonstrated that BSHXD affected IL-17A/IL-17R via PI3K/AKT pathway to promote the proliferative activity of DSCs in URSA. These results provide a new insight to further clarify the relationship between inflammation and apoptosis and the mechanism of imbalance in the dynamic equilibrium between Th17/Treg immune cells at the maternal-fetal interface.

SUBMITTER: Feng X

PROVIDER: S-EPMC7556073 | biostudies-literature | 2020

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

BuShen HuoXue Decoction Promotes Decidual Stromal Cell Proliferation via the PI3K/AKT Pathway in Unexplained Recurrent Spontaneous Abortion.

Feng Xiaoling X Jiang Sha S Leung WingTing W Wang Ling L Gober Hans Jürgen HJ Chen Lu L Zhang Yang Y Wang Ling L

Evidence-based complementary and alternative medicine : eCAM 20201005

BuShen HuoXue decoction (BSHXD) has been used to treat patients with unexplained recurrent spontaneous abortion (URSA). However, the chemical compounds and mechanism by which BSHXD exerts its therapeutic and systemic effects to promote the proliferation of decidual stromal cells (DSCs) has not been elucidated. This work sought to elucidate the cellular and molecular mechanism of BSHXD in terms of inflammatory factors IL-17A in DSCs <i>in vitro</i> because of the critical roles of inflammation, a ...[more]

PMID: 33082827

Similar Datasets

Project description:BackgroundExosomes released from decidual stromal cells (DSC-exos) play a crucial role in facilitating the epithelial-mesenchymal transition (EMT) of trophoblasts and insufficient trophoblasts EMT are associated with URSA (unexplained recurrent spontaneous abortion). However, the mechanisms underlying DSC-exos inducing EMT is not completely understood.MethodsDSC-exos of normal pregnant women (N-DSC-exos) and URSA patients (URSA-DSC-exos) were extracted and characterized. Characterization of the isolated DSC-exos was performed using with TEM (transmission electron microscopy), NTA (nanoparticle tracking analysis), and WB (western blot) techniques. Subsequently, these DSC-exos were co-cultured with trophoblasts cell lines (HTR-8/SVneo). The influence of both N-DSC-exos and URSA-DSC-exos on trophoblasts proliferation, invasion and migration, as well as on the expression of EMT-related proteins, was evaluated through a series of assays including CCK8 assays, wound healing assays, transwell assays, and western blot, respectively. Then rescue experiments were performed by β-TrCP knockdown or β-TrCP overexpressing trophoblasts with snail-siRNA transfection or β-TrCP overexpressing Lentivirus infection, respectively. Finally, animal experiments were employed to explore the effect of N-DSC-exos on embryo absorption in mice.ResultsWe found increased β-TrCP expression in the villus of URSA patients when compared to the normal pregnant women, alongside reduction in the levels of both snail and N-cadherin within URSA patients. N-DSC-exos can promote the EMT of the trophoblast by inhibiting β-TrCP-mediated ubiquitination and degradation of transcription factor snail. Moreover the capacity to promote EMT was found to be more potent in N-DSC-exos than URSA-DSC-exos. Down-regulation of snail or overexpression of β-TrCP can reverse the effects of N-DSC-exos on trophoblast. Finally, in vivo experiment suggested that N-DSC-exos significantly reduced the embryo resorption rate of spontaneous abortion mouse model.ConclusionsOur findings indicate that URSA-DSC-exos caused insufficient migration and invasion of trophoblast because of disturbing of β-TrCP-mediated ubiquitination and degradation of EMT transcription factor snail. Elucidating the underlying mechanism of this dysregulation may shed light on the novel pathways through which DSC-exos influence trophoblast function, thereby contributing to our understanding of their role in URSA.

Project description:BackgroundRecurrent spontaneous abortion (RSA) is intractable infertility and can be ameliorated with the use of traditional Chinese medicine preparation, the Wenjing decoction. This study aimed to identify the therapeutic mechanism of Wenjing decoction on specific target proteins involved in RSA.MethodsWenjing decoction contains Wuzhuyu, Danggui, Chuanxiong, Guizhi, Shengjiang, Banxia, Gancao, Ejiao, Mudanpi, Chishao, Dangshen, and Maidong. Using TCMSP and BATMAN databases, we queried for active ingredients and predicted their target proteins by BATMAN. Using the edgeR package, we analyzed the differentially expressed genes (DEGs) in the GSE121950 database between control samples and RSA (n = 3). The interaction between DEGs and the predicted target proteins was identified by the Venn diagram. Using the Cytoscape software and clusterProfiler package, enrichment analysis was conducted for the intersected target proteins. Additionally, the protein-protein interaction (PPI) network and pharmacological network were generated using the Cytoscape software.ResultsIn total, 31, 2, 7, 7, 5, 13, 93, 11, 29, and 21 active ingredients were identified from Wuzhuyu, Danggui, Chuanxiong, Guizhi, Shengjiang, Banxia, Gancao, Mudanpi, Chishao, and Dangshen, respectively. Additionally, 100 intersected target proteins were revealed by the Venn diagram. Moreover, 98 functional terms and 24 pathways (including C-type lectin receptor signaling pathway, chemokine signaling pathway, leukocyte transendothelial migration, fluid shear stress, and atherosclerosis, and AGE-RAGE signaling pathway in diabetic complications) were enriched. In the PPI network, 10 proteins involved in these five pathways were identified, namely, TNF-α (tumor necrosis factor-α), IL-10 (interleukin-10), TLR4 (Toll-like receptor 4), JUN (Jun proto-oncogene), IL-1B (interleukin-1-beta), CYBB (cytochrome b558 heavy chain gene), PTGS2 (prostaglandin-endoperoxide synthase 2), APOE (apolipoprotein E), SPI1 (salmonella pathogenicity island 1), and MPO (myeloperoxidase) which showed higher degrees.ConclusionThe abovementioned genes and pathways might be involved in the pharmacological activity of Wenjing decoction in RSA.

Project description:Deficiency in decidualization has been widely regarded as an important cause of spontaneous abortion. Generalized decidualization also includes massive infiltration and enrichment of NK cells. However, the underlying mechanism of decidual NK (dNK) cell residence remains largely unknown. Here, we observe that the increased macroautophagy/autophagy of decidual stromal cells (DSCs) during decidualization, facilitates the adhesion and retention of dNK cells during normal pregnancy. Mechanistically, this process is mediated through activation of the MITF-TNFRSF14/HVEM signaling, and further upregulation of multiple adhesion adhesions (e.g. Selectins and ICAMs) in a MMP9-dependent manner. Patients with unexplained spontaneous abortion display insufficient DSC autophagy and dNK cell residence. In addition, poor vascular remodeling of placenta, low implantation number and high ratio of embryo loss are observed in NK cell depletion mice. In therapeutic studies, low doses of rapamycin, a known autophagy inducer that significantly promotes endometrium autophagy and NK cell residence, and improves embryo absorption in spontaneous abortion mice models, which should be dependent on the activation of MITF-TNFRSF14/HVEM-MMP9-adhension molecules axis. This observation reveals novel molecular mechanisms underlying DSCs autophagy-driven dNK cell residence, and provides a potential therapeutic strategy to prevent spontaneous abortion.Abbreviations: ACTA2/αSMA: actin alpha 2, smooth muscle; ATG: autophagy-related; ATG5over ESC: ATG5-overexpressed ESCs; BTLA: B and T lymphocyte associated; CDH1: cadherin 1; CDH5: cadherin 5; CXCL12: C-X-C motif chemokine ligand 12; dNK: decidual NK; DIC: decidual immune cell; DSC: decidual stromal cell; EOMES: eomesodermin; ESC: endometrial stromal cell; FCGR3A/CD16: Fc fragment of IgG receptor IIIa; HUVEC: human umbilical vein endothelial cell; ICAM: intercellular cell adhesion molecule; ILC: innate lymphoid cell; ITGB1: integrin subunit beta 1; ITGA2: integrin subunit alpha 2; IPA: Ingenuity Pathway Analysis; KIR2DL1: killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 1; KLRD1/CD94: killer cell lectin like receptor D1; KLRK1/NKG2D: killer cell lectin like receptor K1; MAP1LC3B/LC3B: microtubule associated protein 1 light chain 3 beta; 3-MA: 3-methyladenine; MITF: melanocyte inducing transcription factor; MiT-TFE: microphthalmia family of bHLH-LZ transcription factors; MMP9: matrix metalloproteinase 9; MTOR: mechanistic target of rapamycin kinase; NCAM1/CD56: neural cell adhesion molecule 1; NCR2/NKp44: natural cytotoxicity triggering receptor 2; NK: natural killer; KLRB1/NK1.1: killer cell lectin like receptor B1; NP: normal pregnancy; PBMC: peripheral blood mononuclear cell; PECAM1/CD31: platelet and endothelial cell adhesion molecule 1; pNK: peripheral blood NK; PRF1/Perforin: Perforin 1; PTPRC/CD45: protein tyrosine phosphatase receptor type C; Rapa: rapamycin; rh-TNFSF14/LIGHT: recombinant human TNFSF14/LIGHT; SA: spontaneous abortion; SELE: selectin E; SELP: selectin P; SELL: selectin L; siATG5 DSCs: ATG5-silenced DSCs; siTNFRSF14/HVEM DSCs: TNFRSF14/HVEM-silenced DSCs; TBX21/T-bet: T-box transcription factor 21; SQSTM1/p62: sequestosome 1; TNFRSF14/HVEM: TNF receptor superfamily member 14; TNFSF14/LIGHT: TNF superfamily member 14; uNK: uterine NK; UIC: uterine immune cell; USC: uterine stromal cell; VCAM1: vascular cell adhesion molecule 1; VIM: vimentin.

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.

Dataset Information

BuShen HuoXue Decoction Promotes Decidual Stromal Cell Proliferation via the PI3K/AKT Pathway in Unexplained Recurrent Spontaneous Abortion.

Publications

BuShen HuoXue Decoction Promotes Decidual Stromal Cell Proliferation via the PI3K/AKT Pathway in Unexplained Recurrent Spontaneous Abortion.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets