Polarization disorder of decidual NK cells in unexplained recurrent spontaneous abortion revealed by single-cell transcriptome analysis.
Ontology highlight
ABSTRACT: Background
Unexplained recurrent spontaneous abortion (URSA) is one of the most common diseases in pregnancy and is mainly caused by immune disorders. The foetus is similar to semiallogeneic maternal tissue, so the balance of immune tolerance must be dynamically maintained during pregnancy. Decidual natural killer (dNK) cells primarily mediate the immune tolerance microenvironment at the maternal-fetal interface. By using single-cell RNA sequencing (scRNA-seq) and high-throughput transcriptome sequencing analysis, we explored the characteristic distribution of dNK cells in URSA patients.Methods
Control maternal-fetal interface tissue (from normal pregnant women, n = 3) and case maternal-fetal interface tissue (from patients with URSA, n = 3) samples were analysed by scRNA-seq and high-throughput transcriptome sequencing.Results
By scRNA-seq, we demonstrated the maturation process of the transition of dNK cells from cytotoxic characteristics to immune tolerance in transcriptome analysis. Moreover, compared with normal pregnant women, serious disturbances in the polarization process of dNK cells were found in URSA. Simultaneously, the transcriptional level of the extracellular matrix (ECM) in URSA patients showed a significant decrease. The dNK cells interacted with extravillous trophoblasts to achieve immune-tolerant polarization.Conclusions
Insufficient expression of KIRs during dNK cell differentiation might be a key reason why polarized dNK cells still had high cytotoxic reactivity in URSA patients. Abnormal expression of ECM may affect the interaction of dNK cells with EVTs, making dNK cells immature. Both resulted in maternal immune intolerance to the foetus during pregnancy.
SUBMITTER: Pan D
PROVIDER: S-EPMC9327377 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:BuShen HuoXue decoction (BSHXD) has been used to treat patients with unexplained recurrent spontaneous abortion (URSA). However, the chemical compounds and mechanism by which BSHXD exerts its therapeutic and systemic effects to promote the proliferation of decidual stromal cells (DSCs) has not been elucidated. This work sought to elucidate the cellular and molecular mechanism of BSHXD in terms of inflammatory factors IL-17A in DSCs in vitro because of the critical roles of inflammation, apoptosis, and immunity in the development and progression of pregnancy loss. Twelve migratory chemical compounds from BSHXD extract were qualitatively analyzed by high-performance liquid chromatography (HPLC). DSCs were collected from normal early pregnancy (NEP) and URSA to determine whether BSHXD affects IL-17A/IL17RA via the PI3K/AKT pathway. Abnormal apoptosis and activated p-AKT were observed in URSA DSCs. RhIL-17 A, LY294002 (a PI3K pathway inhibitor), and BSHXD were individually or simultaneously administered in NEP DSCs, suggesting that BSHXD restored cell proliferation without excessive stimulation and IL-17A promotes proliferation via the PI3K/AKT pathway. Using the same intervention in URSA DSCs, qRT-PCR measured the upregulated mRNA levels of IL-17 A/IL-17RA, PI3K, AKT, p-AKT, PTEN, Bcl-2, and Bcl-xL and downregulated mRNA levels of BAD and ACT1 after treatment with BSHXD. We demonstrated that BSHXD affected IL-17A/IL-17R via PI3K/AKT pathway to promote the proliferative activity of DSCs in URSA. These results provide a new insight to further clarify the relationship between inflammation and apoptosis and the mechanism of imbalance in the dynamic equilibrium between Th17/Treg immune cells at the maternal-fetal interface.
| S-EPMC7556073 | biostudies-literature
Project description:Unexplained recurrent spontaneous abortion (URSA) is believed to be associated with impaired immunosuppression at the maternal-fetal interface, but the detailed molecular mechanism remains unclear. The ATP-adenosine metabolic pathway regulated by CD39/CD73 has recently been recognized to be important in immunosuppression. This study aimed to investigate the regulation of decidual natural killer (dNK) cells and fetal extravillous trophoblast (EVT) cells by CD39 and CD73 in URSA, as well as the possible regulatory mechanism of CD39/CD73 via the TGF-β-mTOR-HIF-1α pathway using clinical samples and cell models. Fewer CD39+ and CD73+ cells were found in the URSA decidual and villous tissue, respectively. Inhibition of CD39 on dNK cells transformed the cells to an activated state with increased toxicity and decreased apoptosis, and changed their cytokine secretion, leading to impaired invasion and proliferation of the co-cultured HTR8/SVneo cells. Similarly, inhibition of CD73 on HTR8/SVneo cells decreased the adenosine concentration in the cell culture media, increased the proportion of CD107a+ dNK cells, and decreased the invasion and proliferation capabilities of the HTR8/SVneo cells. In addition, transforming growth factor-β (TGF-β) triggered phosphorylation of mammalian target of rapamycin (mTOR) and Smad2/Smad3, which subsequently activated hypoxia-inducible factor-1α (HIF-1α) to induce the CD73 expression on the HTR8/SVneo cells. In summary, reduced numbers of CD39+ and CD73+ cells at the maternal-fetal interface, which may be due to downregulated TGF-β-mTOR-HIF-1α pathway, results in reduced ATP-adenosine metabolism and increased dNK cytotoxicity, and potentially contributes to URSA occurrences.
| S-EPMC8866181 | biostudies-literature
Project description:Dysregulation of decidual macrophages leads to the occurrence of recurrent spontaneous abortion (RSA). However, the role of macrophages in RSA occurrence remains unclear. In this study, we found that the expression of Grim-19 was decreased, and the expression of autophagy related proteins Beclin1, LC3B II/I and BNIP3 was markedly upregulated in decidual macrophages of RSA patients compared with the normal pregnancy group. Furthermore, we demonstrated that downregulation of GRIM-19 increased the expression of autophagy related proteins Beclin1, LC3B II/I, BNIP3 and the proinflammatory cytokines IL1B, IL6 and TNFa in uterine mononuclear cells of GRIM-19+/- mice. The proportion of CD45+CD11b+F4/80+LC3B+ cells in GRIM-19+/- mouse uteri was significantly higher than that in WT mouse uteri. In addition, we confirmed that inhibition of Grim-19 by siRNA enhanced the expression of autophagy related proteins in RAW264.7 cells and THP-1 cells. More importantly, downregulation of Grim-19 in RAW264.7 cells promoted the release of proinflammatory cytokines and promoted phagocytic activity, which could be reversed by autophagy blockade. For THP-1-derived macrophages, the results of RNA-seq suggested that Grim-19 mainly modulates immune and inflammatory-related pathways, leading to cytokine production, and thus contributing to inflammation. Therefore, our data reveal that Grim-19 deficiency influences macrophage function, characterized by enhanced proinflammatory cytokines and phagocytic activity, and this might be regulated by autophagy. This may represent a novel mechanism for the occurrence of RSA.
| S-EPMC9641028 | biostudies-literature
Project description:The specific causes of recurrent spontaneous abortion (RSA) remain unknown in 37-79% of affected women. The aim of this study was to explore the expression levels of 6 miRNAs in natural killer (NK) cells from the decidua of patients with unexplained RSA (URSA) and to predict the target genes of 3 miRNAs.Two groups were examined: URSA (n=20) and controls (n=20). Flow cytometry analysis was used to identify NK cells isolated from the decidua. Transcriptional levels of miRNA were monitored using quantitative real-time reverse transcription-polymerase chain reaction. Prediction and analysis of mRNA targets of differentially expressed miRNAs were performed using bioinformatics methods.Five miRNAs [miR-34a (+281%, P<0.001), miR-155 (+396%, P<0.001), miR-141 (+142%, P<0.01), miR-125a (+279%, P<0.001), and miR-125b (+185%, P<0.001)] were up-regulated, while miR-24 was down-regulated (-64%, P<0.01) in the URSA group, compared to the control group. This study identified potential miRNA targets: miR-34a-3p/5p, 585/1718 (targets of miR-34a-3p/targets of miR-34a-5p), miR-141-3p/5p, 2270/629 (targets of miR-141-3p/targets of miR-141-5p), and miR-24, 2320 target genes. A total of 140 pathways related to target genes were identified including PI3K-Akt, focal adhesion, MAPK, Wnt, regulation of the actin cytoskeleton, T cell receptor, TGF-?, and estrogen signaling pathways.This study suggests that miR-34a-3p/5p, miR-141-3p/5p, and miR-24 in decidual NK cells could be associated with URSA. These findings might contribute to the panel of diagnostic and prognostic biomarkers with clinical utility, and facilitate the development of new strategies for targeted therapy against URSA.
| S-EPMC4805134 | biostudies-literature
Project description:Deficiency in decidualization has been widely regarded as an important cause of spontaneous abortion. Generalized decidualization also includes massive infiltration and enrichment of NK cells. However, the underlying mechanism of decidual NK (dNK) cell residence remains largely unknown. Here, we observe that the increased macroautophagy/autophagy of decidual stromal cells (DSCs) during decidualization, facilitates the adhesion and retention of dNK cells during normal pregnancy. Mechanistically, this process is mediated through activation of the MITF-TNFRSF14/HVEM signaling, and further upregulation of multiple adhesion adhesions (e.g. Selectins and ICAMs) in a MMP9-dependent manner. Patients with unexplained spontaneous abortion display insufficient DSC autophagy and dNK cell residence. In addition, poor vascular remodeling of placenta, low implantation number and high ratio of embryo loss are observed in NK cell depletion mice. In therapeutic studies, low doses of rapamycin, a known autophagy inducer that significantly promotes endometrium autophagy and NK cell residence, and improves embryo absorption in spontaneous abortion mice models, which should be dependent on the activation of MITF-TNFRSF14/HVEM-MMP9-adhension molecules axis. This observation reveals novel molecular mechanisms underlying DSCs autophagy-driven dNK cell residence, and provides a potential therapeutic strategy to prevent spontaneous abortion.Abbreviations: ACTA2/αSMA: actin alpha 2, smooth muscle; ATG: autophagy-related; ATG5over ESC: ATG5-overexpressed ESCs; BTLA: B and T lymphocyte associated; CDH1: cadherin 1; CDH5: cadherin 5; CXCL12: C-X-C motif chemokine ligand 12; dNK: decidual NK; DIC: decidual immune cell; DSC: decidual stromal cell; EOMES: eomesodermin; ESC: endometrial stromal cell; FCGR3A/CD16: Fc fragment of IgG receptor IIIa; HUVEC: human umbilical vein endothelial cell; ICAM: intercellular cell adhesion molecule; ILC: innate lymphoid cell; ITGB1: integrin subunit beta 1; ITGA2: integrin subunit alpha 2; IPA: Ingenuity Pathway Analysis; KIR2DL1: killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 1; KLRD1/CD94: killer cell lectin like receptor D1; KLRK1/NKG2D: killer cell lectin like receptor K1; MAP1LC3B/LC3B: microtubule associated protein 1 light chain 3 beta; 3-MA: 3-methyladenine; MITF: melanocyte inducing transcription factor; MiT-TFE: microphthalmia family of bHLH-LZ transcription factors; MMP9: matrix metalloproteinase 9; MTOR: mechanistic target of rapamycin kinase; NCAM1/CD56: neural cell adhesion molecule 1; NCR2/NKp44: natural cytotoxicity triggering receptor 2; NK: natural killer; KLRB1/NK1.1: killer cell lectin like receptor B1; NP: normal pregnancy; PBMC: peripheral blood mononuclear cell; PECAM1/CD31: platelet and endothelial cell adhesion molecule 1; pNK: peripheral blood NK; PRF1/Perforin: Perforin 1; PTPRC/CD45: protein tyrosine phosphatase receptor type C; Rapa: rapamycin; rh-TNFSF14/LIGHT: recombinant human TNFSF14/LIGHT; SA: spontaneous abortion; SELE: selectin E; SELP: selectin P; SELL: selectin L; siATG5 DSCs: ATG5-silenced DSCs; siTNFRSF14/HVEM DSCs: TNFRSF14/HVEM-silenced DSCs; TBX21/T-bet: T-box transcription factor 21; SQSTM1/p62: sequestosome 1; TNFRSF14/HVEM: TNF receptor superfamily member 14; TNFSF14/LIGHT: TNF superfamily member 14; uNK: uterine NK; UIC: uterine immune cell; USC: uterine stromal cell; VCAM1: vascular cell adhesion molecule 1; VIM: vimentin.
| S-EPMC8496707 | biostudies-literature
Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.
| S-EPMC9201170 | biostudies-literature
Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.
| S-EPMC10280933 | biostudies-literature
Project description:BackgroundExosomes released from decidual stromal cells (DSC-exos) play a crucial role in facilitating the epithelial-mesenchymal transition (EMT) of trophoblasts and insufficient trophoblasts EMT are associated with URSA (unexplained recurrent spontaneous abortion). However, the mechanisms underlying DSC-exos inducing EMT is not completely understood.MethodsDSC-exos of normal pregnant women (N-DSC-exos) and URSA patients (URSA-DSC-exos) were extracted and characterized. Characterization of the isolated DSC-exos was performed using with TEM (transmission electron microscopy), NTA (nanoparticle tracking analysis), and WB (western blot) techniques. Subsequently, these DSC-exos were co-cultured with trophoblasts cell lines (HTR-8/SVneo). The influence of both N-DSC-exos and URSA-DSC-exos on trophoblasts proliferation, invasion and migration, as well as on the expression of EMT-related proteins, was evaluated through a series of assays including CCK8 assays, wound healing assays, transwell assays, and western blot, respectively. Then rescue experiments were performed by β-TrCP knockdown or β-TrCP overexpressing trophoblasts with snail-siRNA transfection or β-TrCP overexpressing Lentivirus infection, respectively. Finally, animal experiments were employed to explore the effect of N-DSC-exos on embryo absorption in mice.ResultsWe found increased β-TrCP expression in the villus of URSA patients when compared to the normal pregnant women, alongside reduction in the levels of both snail and N-cadherin within URSA patients. N-DSC-exos can promote the EMT of the trophoblast by inhibiting β-TrCP-mediated ubiquitination and degradation of transcription factor snail. Moreover the capacity to promote EMT was found to be more potent in N-DSC-exos than URSA-DSC-exos. Down-regulation of snail or overexpression of β-TrCP can reverse the effects of N-DSC-exos on trophoblast. Finally, in vivo experiment suggested that N-DSC-exos significantly reduced the embryo resorption rate of spontaneous abortion mouse model.ConclusionsOur findings indicate that URSA-DSC-exos caused insufficient migration and invasion of trophoblast because of disturbing of β-TrCP-mediated ubiquitination and degradation of EMT transcription factor snail. Elucidating the underlying mechanism of this dysregulation may shed light on the novel pathways through which DSC-exos influence trophoblast function, thereby contributing to our understanding of their role in URSA.
| S-EPMC10775448 | biostudies-literature
Project description:Human leukocyte antigen-E (HLA-E)is a non-classical major histocompatibility complex (MHC) class I antigens which expressed on extra villous cytotrophoblast, which interacts with NKG2A, is an inhibitory receptor on natural killer (NK) cells and leading to down regulation of immune response in the maternal-fetal interface and provides maternal immune tolerance of the fetus.This study was designated to investigate the gene frequencies of E0101 and E0103 in HLA-E gene in Iranian women with recurrent spontaneous abortion (RSA).Amplification Refractory Mutation System (ARMS-PCR) technique was carried out to detect polymorphism in exon 3 of the HLA-E gene in women with RSA and controls (n=200). Differences between groups were analyzed by SPSS19 software using (2) test.There was no significant difference in the allele frequencies of the HLA-E polymorphism between RSA and fertile controls but HLA-E 0101/0103 heterozygous genotype was found to be significantly higher in RSA group (p=0.006, OR=1.73), so this genotype might confer susceptibility to RSA.Our results suggest that HLA-E 0101/0103 heterozygous genotype leads to increase of RSA risk. It seems that by genotyping of HLA-E polymorphism, we can predict the risk of RSA in infertile women.
| S-EPMC4971558 | biostudies-other
Project description:BACKGROUND:Recurrent Spontaneous Abortion (RSA) is caused by multiple genetic and non-genetic factors. Around 50% of the RSA cases have no known etiology and are considered as Unexplained RSA (URSA). Estrogens, via binding to their receptors, play an important role in female reproduction. This study aimed to investigate whether single nucleotide polymorphisms (SNPs; +1082G/A, +1730G/A and rs1256030 C/T) in the estrogen receptor beta (ESR2) gene are associated with susceptibility to URSA in a population of Iranian women. METHODS:In this case-control study, the study groups consisted of 240 subjects with a history of URSA and 102 fertile women as controls. Serum levels of follicle stimulating hormone (FSH), luteinizing hormone (LH), and estradiol (E2) were measured on day 2-3 of menstrual cycle. Two functional SNPs, +1082G/A (a silent mutation in exon 5) and +1730G/A (3' untranslated region of the exon 8), and one intron, rs1256030C/T, in the ESR2 gene were genotyped, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. RESULTS:Serum levels of LH were significantly increased in URSA women. No significant differences in distribution of +1082G/A, +1730G/A and rs1256030C/T between URSA and control groups were observed. CONCLUSION:Our findings suggest that the studied SNPs on ESR2 gene may not be associated with URSA.
| S-EPMC5501144 | biostudies-literature