Dataset Information

Parp3 promotes astrocytic differentiation through a tight regulation of Nox4-induced ROS and mTorc2 activation.

ABSTRACT: Parp3 is a member of the Poly(ADP-ribose) polymerase (Parp) family that has been characterized for its functions in strand break repair, chromosomal rearrangements, mitotic segregation and tumor aggressiveness. Yet its physiological implications remain unknown. Here we report a central function of Parp3 in the regulation of redox homeostasis in continuous neurogenesis in mice. We show that the absence of Parp3 provokes Nox4-induced oxidative stress and defective mTorc2 activation leading to inefficient differentiation of post-natal neural stem/progenitor cells to astrocytes. The accumulation of ROS contributes to the decreased activity of mTorc2 as a result of an oxidation-induced and Fbxw7-mediated ubiquitination and degradation of Rictor. In vivo, mTorc2 signaling is compromised in the striatum of naïve post-natal Parp3-deficient mice and 6?h after acute hypoxia-ischemia. These findings reveal a physiological function of Parp3 in the tight regulation of striatal oxidative stress and mTorc2 during astrocytic differentiation and in the acute phase of hypoxia-ischemia.

SUBMITTER: Rodriguez-Vargas JM

PROVIDER: S-EPMC7648797 | biostudies-literature | 2020 Nov

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Parp3 promotes astrocytic differentiation through a tight regulation of Nox4-induced ROS and mTorc2 activation.

Rodriguez-Vargas José-Manuel JM Martin-Hernandez Kathline K Wang Wei W Kunath Nicolas N Suganthan Rajikala R Amé Jean-Christophe JC Oliver F Javier FJ Ye Jing J Bjørås Magnar M Dantzer Françoise F

Cell death & disease 20201106 11

Parp3 is a member of the Poly(ADP-ribose) polymerase (Parp) family that has been characterized for its functions in strand break repair, chromosomal rearrangements, mitotic segregation and tumor aggressiveness. Yet its physiological implications remain unknown. Here we report a central function of Parp3 in the regulation of redox homeostasis in continuous neurogenesis in mice. We show that the absence of Parp3 provokes Nox4-induced oxidative stress and defective mTorc2 activation leading to inef ...[more]

PMID: 33159039

Similar Datasets

Project description:Stromal remodeling, in particular fibroblast-to-myofibroblast differentiation, is a hallmark of benign prostatic hyperplasia (BPH) and solid tumors, including prostate cancer (PCa). Increased local production of TGFβ1 is considered the inducing stimulus. Given that stromal remodeling actively promotes BPH/PCa development, there is considerable interest in developing stromal-targeted therapies. Microarray and quantitative PCR analysis of primary human prostatic stromal cells induced to undergo fibroblast-to-myofibroblast differentiation with TGFβ1 revealed up-regulation of the reactive oxygen species (ROS) producer reduced nicotinamide adenine dinucleotide phosphate oxidase 4 (NOX4) and down-regulation of the selenium-containing ROS-scavenging enzymes glutathione peroxidase 3, thioredoxin reductase 1 (TXNRD1), and the selenium transporter selenoprotein P plasma 1. Consistently, NOX4 expression correlated specifically with the myofibroblast phenotype in vivo, and loss of selenoprotein P plasma 1 was observed in tumor-associated stroma of human PCa biopsies. Using lentiviral NOX4 short hairpin RNA-mediated knockdown, pharmacological inhibitors, antioxidants, and selenium, we demonstrate that TGFβ1 induction of NOX4-derived ROS is required for TGFβ1-mediated phosphorylation of c-jun N-terminal kinase, which in turn is essential for subsequent downstream cytoskeletal remodeling. Significantly, selenium supplementation inhibited differentiation by increasing ROS-scavenging selenoenzyme biosynthesis because glutathione peroxidase 3 and TXNRD1 expression and TXNRD1 enzyme activity were restored. Consistently, selenium depleted ROS levels downstream of NOX4 induction. Collectively, this work demonstrates that dysregulated redox homeostasis driven by elevated NOX4-derived ROS signaling underlies fibroblast-to-myofibroblast differentiation in the diseased prostatic stroma. Further, these data indicate the potential clinical value of selenium and/or NOX4 inhibitors in preventing the functional pathogenic changes of stromal cells in BPH and PCa.

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.

Dataset Information

Parp3 promotes astrocytic differentiation through a tight regulation of Nox4-induced ROS and mTorc2 activation.

Publications

Parp3 promotes astrocytic differentiation through a tight regulation of Nox4-induced ROS and mTorc2 activation.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets