Dataset Information

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

ABSTRACT:

Background

In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously.

Methods

The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected.

Results

The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load?>?3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found.

Conclusion

With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

SUBMITTER: Zheng Y

PROVIDER: S-EPMC7891017 | biostudies-literature | 2021 Feb

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

Zheng Yi Y Zhao Youyun Y Wang Yefu Y Rao Jun J

Virology journal 20210218 1

<h4>Background</h4>In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously.<h4>Methods</h4>The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize th ...[more]

PMID: 33602271

Similar Datasets

Project description:Dengue fever results from infection with one or more of four different serotypes of dengue virus (DENV). Despite the widespread nature of this infection, available molecular diagnostics have significant limitations. The aim of this study was to develop a multiplex, real-time, reverse transcriptase-PCR (rRT-PCR) for the detection, quantitation, and serotyping of dengue viruses in a single reaction.An rRT-PCR assay targeting the 5' untranslated region and capsid gene of the DENV genome was designed using molecular beacons to provide serotype specificity. Using reference DENV strains, the assay was linear from 7.0 to 1.0 log?? cDNA equivalents/µL for each serotype. The lower limit of detection using genomic RNA was 0.3, 13.8, 0.8, and 12.4 cDNA equivalents/µL for serotypes 1-4, respectively, which was 6- to 275-fold more analytically sensitive than a widely used hemi-nested RT-PCR. Using samples from Nicaragua collected within the first five days of illness, the multiplex rRT-PCR was positive in 100% (69/69) of specimens that were positive by the hemi-nested assay, with full serotype agreement. Furthermore, the multiplex rRT-PCR detected DENV RNA in 97.2% (35/36) of specimens from Sri Lanka positive for anti-DENV IgM antibodies compared to just 44.4% (16/36) by the hemi-nested RT-PCR. No amplification was observed in 80 clinical samples sent for routine quantitative hepatitis C virus testing or when genomic RNA from other flaviviruses was tested.This single-reaction, quantitative, multiplex rRT-PCR for DENV serotyping demonstrates superior analytical and clinical performance, as well as simpler workflow compared to the hemi-nested RT-PCR reference. In particular, this multiplex rRT-PCR detects viral RNA and provides serotype information in specimens collected more than five days after fever onset and from patients who had already developed anti-DENV IgM antibodies. The implementation of this assay in dengue-endemic areas has the potential to improve both dengue diagnosis and epidemiologic surveillance.

Project description:IntroductionCalf diarrhea is a significant condition that has a strong effect on the cattle industry, resulting in huge economic losses annually. Bovine torovirus (BToV), bovine enterovirus (BEV), bovine norovirus (BNoV), bovine coronavirus (BCoV), bovine rotavirus (BRV), and bovine viral diarrhea virus (BVDV) are key pathogens that have been implicated in calf diarrhea. Among these viruses, there remains limited research on BToV, BEV, and BNoV, with no available vaccines or drugs for their prevention and control. Although commercial vaccines exist for BCoV, BRV, and BVDV, the prevalence of these diseases remains high.MethodsTo address this issue, we developed a multiplex real-time fluorescence quantitative PCR method for detecting BToV, BEV, BNoV, BCoV, BRV, and BVDV. This method can be used to effectively monitor the prevalence of these six viruses and serve as a reference for future prevention and control strategies. In this study, we specifically designed primers and probes for the BNoV Rdrp, BEV 5'UTR, BToV M, BCoV N, BRV NSP5, and BVDV 5'UTR genes.ResultsThis method was determined to be efficient, stable, and sensitive. The lowest detectable levels of plasmids for BNoV, BEV, BToV, BRV, BCoV, and BVDV were 1.91 copies/μL, 96.0 copies/μL, 12.8 copies/μL, 16.4 copies/μL, 18.2 copies/μL, and 65.3 copies/μL, respectively. Moreover, the coefficients of variation for all six detection methods were < 3%; they also exhibited a strong linear relationship (R2 ≥ 0.98), and an amplification efficiency of 90%-110%. A total of 295 fecal and anal swabs were collected from calves with diarrhea in Guangdong, China. The positive rates for BToV, BEV, BNoV, BCoV, BR, and BVDV were determined to be 0.34% (1/295), 6.10% (18/295), 0.68% (2/295), 1.36% (4/295), 10.85% (32/295), and 2.03% (6/295), respectively. Notably, BEV and BRV exhibited the highest prevalence.DiscussionAdditionally, this study identified the occurrence of BToV and BNoV in Guangdong for the first time. In summary, this study successfully established an effective method for detecting several important bovine viruses; ultimately, this holds strong implications for the future development of the cattle industry.

Dataset Information

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

Background

Methods

Results

Conclusion

Publications

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets