Cytomegalovirus quantitation by real-time PCR is unaffected by delayed separation of plasma from whole blood.
Ontology highlight
ABSTRACT:
SUBMITTER: Nesbitt SE
PROVIDER: S-EPMC356862 | biostudies-other | 2004 Mar
REPOSITORIES: biostudies-other
Similar Datasets
Project description:Quantitation of cytomegalovirus (CMV) viral load in the transplant patients has become a standard practice for monitoring the response to antiviral therapy. The cut-off values of CMV viral load assays for preemptive therapy are different due to the various assay designs employed. To establish a sensitive and reliable diagnostic assay for preemptive therapy of CMV infection, two commercial automated platforms including m2000sp extraction system integrated the Abbott RealTime (m2000rt) and the Roche COBAS AmpliPrep for extraction integrated COBAS Taqman (CAP/CTM) were evaluated using WHO international CMV standards and 110 plasma specimens from transplant patients. The performance characteristics, correlation, and workflow of the two platforms were investigated. The Abbott RealTime assay correlated well with the Roche CAP/CTM assay (R2 = 0.9379, P<0.01). The Abbott RealTime assay exhibited higher sensitivity for the detection of CMV viral load, and viral load values measured with Abbott RealTime assay were on average 0.76 log10 IU/mL higher than those measured with the Roche CAP/CTM assay (P<0.0001). Workflow analysis on a small batch size at one time, using the Roche CAP/CTM platform had a shorter hands-on time than the Abbott RealTime platform. In conclusion, these two assays can provide reliable data for different purpose in a clinical virology laboratory setting.
| S-EPMC4975419 | biostudies-literature
Project description:This study proposes a capillary dielectrophoretic chip to separate blood cells from a drop of whole blood (approximately 1 μl) sample using negative dielectrophoretic force. The separating efficiency was evaluated by analyzing the image before and after dielectrophoretic force manipulation. Blood samples with various hematocrits (10%-60%) were tested with varied separating voltages and chip designs. In this study, a chip with 50 μm gap design achieved a separation efficiency of approximately 90% within 30 s when the hematocrit was in the range of 10%-50%. Furthermore, glucose concentration was electrochemically measured by separating electrodes following manipulation. The current response increased significantly (8.8-fold) after blood cell separation, which was attributed not only to the blood cell separation but also to sample disturbance by the dielectrophoretic force.
| S-EPMC3645465 | biostudies-other
Project description:We have developed a real-time genotyping and quantitative PCR (RT-GQ-PCR) assay to genotype cytomegalovirus (CMV) and quantify viral loads simultaneously in solid organ transplant (SOT) recipients. Special minor-groove DNA-binding probes were designed based on sequence polymorphism in the gB gene to increase genotyping specificity for gB1 to gB4. For validation, 28 samples with known genotypes determined by restriction fragment analysis (RFA) and 121 with unknown genotypes were tested. All samples were from SOT patients with CMV viremia. A 100% concordance for genotyping was achieved by using the RT-GQ-PCR with known genotypes determined by RFA. The RT-GQ-PCR identified more cases of CMV infections with mixed genotypes than RFA did. No cross-reaction between genotypes was observed. All four gB genotypes were detected in the 121 samples of unknown genotype. gB1 was the predominant single genotype (n = 61, 50.4%), followed by gB2 (n = 26, 21.0%), gB3, (n = 11, 9.1%), and gB4 (n = 3, 2.5%). Mixed-genotype infections were detected in 17% (20/121) of the samples. Patients with mixed-genotype infections had significantly higher CMV viral loads than those with single-genotype infections (P = 0.019). The RT-GQ-PCR assay was found to be highly sensitive and specific, with a wide dynamic range (2.7 to 10.7 log(10) copies/ml) and very good precision (coefficient of variation, approximately 1.78%). With the prominent feature of concurrent CMV gB genotyping and quantitation in a single reaction, the new assay provides a rapid and cost-effective method for monitoring CMV infection in SOT recipients.
| S-EPMC2593284 | biostudies-literature
Project description:BackgroundIn recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously.MethodsThe blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected.ResultsThe correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found.ConclusionWith the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
| S-EPMC7891017 | biostudies-literature
Project description:In this research work, we present a simple and efficient passive microfluidic device for plasma separation from pure blood. The microdevice has been fabricated using conventional photolithography technique on a single layer of polydimethylsiloxane, and has been extensively tested on whole blood and enhanced (upto 62%) hematocrit levels of human blood. The microdevice employs elevated dimensions of about 100??m; such elevated dimensions ensure clog-free operation of the microdevice and is relatively easy to fabricate. We show that our microdevice achieves almost 100% separation efficiency on undiluted blood in the flow rate range of 0.3 to 0.5?ml/min. Detailed biological characterization of the plasma obtained from the microdevice is carried out by testing: proteins by ultra-violet spectrophotometric method, hCG (human chorionic gonadotropin) hormone, and conducting random blood glucose test. Additionally, flow cytometry study has also been carried on the separated plasma. These tests attest to the high quality of plasma recovered. The microdevice developed in this work is an outcome of extensive experimental research on understanding the flow behavior and separation phenomenon of blood in microchannels. The microdevice is compact, economical and effective, and is particularly suited in continuous flow operations.
| S-EPMC4899686 | biostudies-literature
Project description:Fundamental understanding of rabbit immunology and the use of the rabbit as a disease model have long been hindered by the lack of immunological assays specific to this species. In the present study, we sought to develop a method to quantitate cytokine expression in rabbit cells and tissues. We report the development of a quantitative real-time RT-PCR method for measuring the relative levels of rabbit IFN-gamma, IL-2, IL-4, IL-10 and TNF-alpha mRNA. Quantitation was accomplished by comparison to a standard curve generated using plasmid DNA containing partial sequences of the relevant cytokines. Experimental studies demonstrate applicability of this assay to quantitate cytokine mRNA levels from rabbit spleen cells following mitogen stimulation. We have further utilized this assay to also examine cytokine expression in rabbit tissues during experimental syphilis infection.
| S-EPMC2041851 | biostudies-literature
Project description:Quantitative real-time PCR (QRT-PCR) has been widely implemented for clinical viral load testing, but a lack of standardization and relatively poor precision have hindered its usefulness. Digital PCR offers highly precise, direct quantification without requiring a calibration curve. Performance characteristics of real-time PCR were compared to those of droplet digital PCR (ddPCR) for cytomegalovirus (CMV) load testing. Tenfold serial dilutions of the World Health Organization (WHO) and the National Institute of Standards and Technology (NIST) CMV quantitative standards were tested, together with the AcroMetrix CMV tc panel (Life Technologies, Carlsbad, CA) and 50 human plasma specimens. Each method was evaluated using all three standards for quantitative linearity, lower limit of detection (LOD), and accuracy. Quantitative correlation, mean viral load, and variability were compared. Real-time PCR showed somewhat higher sensitivity than ddPCR (LODs, 3 log(10) versus 4 log(10) copies/ml and IU/ml for NIST and WHO standards, respectively). Both methods showed a high degree of linearity and quantitative correlation for standards (R(2) ? 0.98 in each of 6 regression models) and clinical samples (R(2) = 0.93) across their detectable ranges. For higher concentrations, ddPCR showed less variability than QRT-PCR for the WHO standards and AcroMetrix standards (P < 0.05). QRT-PCR showed less variability and greater sensitivity than did ddPCR in clinical samples. Both digital and real-time PCR provide accurate CMV load data over a wide linear dynamic range. Digital PCR may provide an opportunity to reduce the quantitative variability currently seen using real-time PCR, but methods need to be further optimized to match the sensitivity of real-time PCR.
| S-EPMC3553899 | biostudies-other
Project description:A potential benefit of digital PCR is a reduction in result variability across assays and platforms. Three sets of PCR reagents were tested on two digital PCR systems (Bio-Rad and RainDance), using three different sets of PCR reagents for quantitation of cytomegalovirus (CMV). Both commercial quantitative viral standards and 16 patient samples (n = 16) were tested. Quantitative accuracy (compared to nominal values) and variability were determined based on viral standard testing results. Quantitative correlation and variability were assessed with pairwise comparisons across all reagent-platform combinations for clinical plasma sample results. The three reagent sets, when used to assay quantitative standards on the Bio-Rad system, all showed a high degree of accuracy, low variability, and close agreement with one another. When used on the RainDance system, one of the three reagent sets appeared to have a much better correlation to nominal values than did the other two. Quantitative results for patient samples showed good correlation in most pairwise comparisons, with some showing poorer correlations when testing samples with low viral loads. Digital PCR is a robust method for measuring CMV viral load. Some degree of result variation may be seen, depending on platform and reagents used; this variation appears to be greater in samples with low viral load values.
| S-EPMC5035403 | biostudies-literature
Project description:Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.
| S-EPMC5857286 | biostudies-literature
Project description:A real-time PCR assay was developed to quantify human cytomegalovirus (CMV) DNA. This assay was used to demonstrate a higher CMV DNA load in plasma of bone marrow transplant patients than in that of blood donors. The CMV load was higher in CMV antigen-positive patients than in antigen-negative patients.
| S-EPMC87012 | biostudies-literature