Browse
Submit Data
Databases
API
Help

Dataset Information

24 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

C-type natriuretic peptide slows down wound healing but promotes angiogenesis in SKH1-hr hairless mice.

ABSTRACT: C-type natriuretic peptide (CNP) is known to increase growth rate of endothelial cells in vitro. In addition, gene transfer of CNP into ischaemic muscle was shown to induce angiogenesis. So far, no study has addressed the effect of CNP on dermal wound healing. The ear wound model in mice was used in this study. The first group was treated with dsRed-CNP plasmid, whereas the second group was transfected with the empty dsRed-sine plasmid, lacking sequence coding for CNP. The third group was sham operated and treated with saline to serve as second control. Wound size was measured on days 0, 1, 3, 5, 7, 9, 11 and 14. On days 7 and 14 capillary density was analysed. Wound closure rate was significantly reduced in mice treated with CNP [dsRed-CNP 73·3 ± 3·2% versus dsRed-sine 94·5 ± 2·4% versus saline 92·1 ± 2·4%, n = 8 per group, analysis of variance (ANOVA) P < 0·001] at day 7 postop. Capillary density was found to be significantly higher in CNP-treated mice (dsRed-CNP 18·7 ± 3·9 versus dsRed-sine 12·3 ± 2·7 versus control 10·1 ± 4·7, CD31(+) capillaries per microscope field, ANOVA P = 0·018) at day 14 postoperative. CNP significantly reduces wound closure rate in hairless mice but promotes the development of new blood vessels. A possible explanation is the dual effect of CNP, inhibiting growth of fibromyoblasts but stimulating growth of endothelial cells. Thus, CNP may serve as a therapeutic approach to diseases caused by hyperfibrosis.

SUBMITTER: Kuehnl A

PROVIDER: S-EPMC7950502 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Enterococcus faecalis Modulates Immune Activation and Slows Healing During Wound Infection.

Project description:Enterococcus faecalis is one of the most frequently isolated bacterial species in wounds yet little is known about its pathogenic mechanisms in this setting. Here, we used a mouse wound excisional model to characterize the infection dynamics of E faecalis and show that infected wounds result in 2 different states depending on the initial inoculum. Low-dose inocula were associated with short-term, low-titer colonization whereas high-dose inocula were associated with acute bacterial replication and long-term persistence. High-dose infection and persistence were also associated with immune cell infiltration, despite suppression of some inflammatory cytokines and delayed wound healing. During high-dose infection, the multiple peptide resistance factor, which is involved in resisting immune clearance, contributes to E faecalis fitness. These results comprehensively describe a mouse model for investigating E faecalis wound infection determinants, and suggest that both immune modulation and resistance contribute to persistent, nonhealing wounds.

| S-EPMC5854026 | biostudies-literature

Comparison of the acute ultraviolet photoresponse in congenic albino hairless C57BL/6J mice relative to outbred SKH1 hairless mice.

Project description:Hairless albino Crl:SKH1-Hr(hr) mice are commonly utilized for studies in which hair or pigmentation would introduce an impediment to observational studies. Being an outbred strain, the SKH1 model suffers from key limitations that are not seen with congenic mouse strains. Inbred and congenic C57BL/6J mice are commonly utilized for modified genetic mouse models. We compare the acute UV-induced photoresponse between outbred SKH1 mice and an immune competent, hairless, albino C57BL/6J congenic mouse line [B6.Cg-Tyr(c-2J) Hr(hr) /J]. Histologically, B6.Cg-Tyr(c-2J) Hr(hr) /J skin is indistinguishable from that of SKH1 mice. The skin of both SKH1 and B6.Cg-Tyr(c-2J) Hr(hr) /J mice exhibited a reduction in hypodermal adipose tissue, the presence of utricles and dermal cystic structures, the presence of dermal granulomas and epidermal thickening. In response to a single 1500 J/m(2) ultraviolet B dose, the oedema and apoptotic responses were equivalent in both mouse strains. However, B6.Cg-Tyr(c-2J) Hr(hr) /J mice exhibited a more robust delayed sunburn reaction, with an increase in epidermal erosion, scab formation and myeloperoxidase activity relative to SKH1 mice. Compared with SKH1 mice, B6.Cg-Tyr(c-2J) Hr(hr) /J also exhibited an aberrant proliferative response to this single UV exposure. Epidermal Ki67 immunopositivity was significantly suppressed in B6.Cg-Tyr(c-2J) Hr(hr) /J mice at 24 h post-UV. A smaller non-significant reduction in Ki67 labelling was observed in SKH1 mice. Finally, at 72 h post-UV, SKH1 mice, but not B6.Cg-Tyr(c-2J) Hr(hr) /J mice, exhibited a significant increase in Ki67 immunolabelling relative to non-irradiated controls. Thus, B6.Cg-Tyr(c-2J) Hr(hr) /J mice are suitable for photobiology experiments.

| S-EPMC5002239 | biostudies-literature

MFG-E8 regulates angiogenesis in cutaneous wound healing.

Project description:Our research group recently demonstrated that pericytes are major sources of the secreted glycoprotein and integrin ligand lactadherin (MFG-E8) in B16 melanoma tumors, and that MFG-E8 promotes angiogenesis via enhanced PDGF-PDGFR? signaling mediated by integrin-growth factor receptor crosstalk. However, sources of MFG-E8 and its possible roles in skin physiology are not well characterized. The objective of this study was to characterize the involvement of MFG-E8 in skin wound healing. In the dermis of normal murine and human skin, accumulations of MFG-E8 were found around CD31(+) blood vessels, and MFG-E8 colocalized with PDGFR?(+), ?SMA(+), and NG2(+) pericytes. MFG-E8 protein and mRNA levels were elevated in the dermis during full-thickness wound healing in mice. MFG-E8 was diffusely present in granulation tissue and was localized around blood vessels. Wound healing was delayed in MFG-E8 knockout mice, compared with the wild type, and myofibroblast and vessel numbers in wound areas were significantly reduced in knockout mice. Inhibition of MFG-E8 production with siRNA attenuated the formation of capillary-like structures in vitro. Expression of MFG-E8 in fibrous human granulation tissue with scant blood vessels was less than that in granulation tissue with many blood vessels. These findings suggest that MFG-E8 promotes cutaneous wound healing by enhancing angiogenesis.

| S-EPMC4076467 | biostudies-literature

Sprouty2 downregulates angiogenesis during mouse skin wound healing.

Project description:Angiogenesis is regulated by signals received by receptor tyrosine kinases such as vascular endothelial growth factor receptors. Mammalian Sprouty (Spry) proteins are known to function by specifically antagonizing the activation of the mitogen-activated protein kinase signaling pathway by receptor tyrosine kinases, a pathway known to promote angiogenesis. To examine the role of Spry2 in the regulation of angiogenesis during wound repair, we used a model of murine dermal wound healing. Full-thickness excisional wounds (3 mm) were made on the dorsum of anesthetized adult female FVB mice. Samples were harvested at multiple time points postwounding and analyzed using real-time RT-PCR, Western blot analysis, and immunofluorescent histochemistry. Spry2 mRNA and protein levels in the wound bed increased significantly during the resolving phases of healing, coincident with the onset of vascular regression in this wound model. In another experiment, intracellular levels of Spry2 or its dominant-negative mutant (Y55F) were elevated by a topical application to the wounds of controlled-release gel containing cell permeable, transactivator of transcription-tagged Spry2, Spry2Y55F, or green fluorescent protein (as control). Wound samples were analyzed for vascularity using CD31 immunofluorescent histochemistry as well as for total and phospho-Erk1/2 protein content. The treatment of wounds with Spry2 resulted in a significant decrease in vascularity and a reduced abundance of phospho-Erk1/2 compared with wounds treated with the green fluorescent protein control. In contrast, the wounds treated with the dominant-negative Spry2Y55F exhibited a moderate increase in vascularity and elevated phospho-Erk1/2 content. These results indicate that endogenous Spry2 functions to downregulate angiogenesis in the healing murine skin wound, potentially by inhibiting the mitogen-activated protein kinase signaling pathway.

| S-EPMC3044050 | biostudies-literature

Inositol requiring enzyme 1? augments angiogenesis for diabetic wound healing

Project description:The microarray analysis is to investigate the different expression profile of microRNAs in bone marrow-derived progenitor cells from type 2 diabetic mice and healthy control mice. microRNA expression profiles were compared between bone marrow-derived progenitor cells from either type 2 diabetic db/db mice or their in-colony control litter db/+ mice. Total RNA was extracted from bone marrow-derived progenitor cells from either type 2 diabetic db/db mice (Jackson lab, # 000642) or their in-colony control litter db/+ mice. N=3 per group.

2015-09-02 | E-GEOD-72616 | biostudies-arrayexpress

The Retinoid Agonist Tazarotene Promotes Angiogenesis and Wound Healing.

Project description:Therapeutic angiogenesis is a major goal of regenerative medicine, but no clinically approved small molecule exists that enhances new blood vessel formation. Here we show, using a phenotype-driven high-content imaging screen of an annotated chemical library of 1,280 bioactive small molecules, that the retinoid agonist Tazarotene, enhances in vitro angiogenesis, promoting branching morphogenesis, and tubule remodeling. The proangiogenic phenotype is mediated by retinoic acid receptor but not retinoic X receptor activation, and is characterized by secretion of the proangiogenic factors hepatocyte growth factor, vascular endothelial growth factor, plasminogen activator, urokinase and placental growth factor, and reduced secretion of the antiangiogenic factor pentraxin-3 from adjacent fibroblasts. In vivo, Tazarotene enhanced the growth of mature and functional microvessels in Matrigel implants and wound healing models, and increased blood flow. Notably, in ear punch wound healing model, Tazarotene promoted tissue repair characterized by rapid ear punch closure with normal-appearing skin containing new hair follicles, and maturing collagen fibers. Our study suggests that Tazarotene, an FDA-approved small molecule, could be potentially exploited for therapeutic applications in neovascularization and wound healing.

| S-EPMC5112045 | biostudies-literature

Opioids: Modulators of angiogenesis in wound healing and cancer.

Project description:Opioids are potent drugs that are widely used to control wound or cancer pain. Increasing evidence suggest that opioids mediate clinically relevant effects that go beyond their classical role as analgesics. Of note, opioids appear to modulate angiogenesis - a process that is critical in wound healing and cancer progression. In this review, we focus on pro- and anti-angiogenic facets of opioids that arise from the activation of individual opioid receptors and the usage of individual concentrations or application routes. We overview the still incompletely elucidated mechanisms of these angiogenic opioid actions. Moreover, we describe plausible opioids effects, which - although not primarily studied in the context of vessel formation - may be related to the opioid-driven processes of angiogenesis. Finally we discuss the use of opioids as an innovative therapeutic avenue for the treatment of chronic wounds and cancer.

| S-EPMC5421968 | biostudies-literature

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

Project description:We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

| S-EPMC4160947 | biostudies-literature

Down-regulation of long non-coding RNA HOTAIR promotes angiogenesis via regulating miR-126/SCEL pathways in burn wound healing.

Project description:miR-126, an endothelial-specific microRNA, is associated to vascular integrity and angiogenesis. It is well established that angiogenesis plays a critical role in burn wound healing. However, there was a lack of understanding of the mechanism by which miR-126 regulates angiogenesis during burn wound healing. HOX transcript antisense intergenic RNA (HOTAIR) is a well-characterized long non-coding RNA (lncRNA) involved in cell proliferation, apoptosis, migration, and invasion of cancer cells. Sciellin (SCEL), a precursor to the cornified envelope of human keratinocytes, has been shown to inhibit migration and invasion capabilities of colorectal cancer cells. In this study, a cohort of 20 burn wound tissues and paired adjacent normal tissues were collected. LncRNA and messenger RNA expression profiles were screened by microarray analysis in five pairs of samples with mostly increased miR-126 levels. miR-126 was highly expressed in burn wound tissues and human umbilical vein endothelial cells (HUVECs) exposed to heat stress, whereas HOTAIR and SCEL were down-regulated after thermal injury. Bioinformatic analysis, dual luciferase reporter assay, and quantitative real-time PCR were conducted to validate that HOTAIR and SCEL competitively bind to miR-126 to function as the competitive endogenous RNA. miR-126 promoted endothelial cell proliferation, migration, and angiogenesis, but suppressed apoptosis, while HOTAIR and SCEL exerted opposite effects in HUVECs. The biological functions were determined by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay, Annexin-V-FITC/PI (propidium iodide/fluorescein isothiocyanate) staining, transwell migration, and tube formation assays. Collectively, our study revealed that HOTAIR/miR-126/SCEL axis contributes to burn wound healing through mediating angiogenesis.

| S-EPMC6978466 | biostudies-literature

Broad-Spectrum Inhibition of the CC-Chemokine Class Improves Wound Healing and Wound Angiogenesis.

Project description:Angiogenesis is involved in the inflammation and proliferation stages of wound healing, to bring inflammatory cells to the wound and provide a microvascular network to maintain new tissue formation. An excess of inflammation, however, leads to prolonged wound healing and scar formation, often resulting in unfavourable outcomes such as amputation. CC-chemokines play key roles in the promotion of inflammation and inflammatory-driven angiogenesis. Therefore, inhibition of the CC-chemokine class may improve wound healing. We aimed to determine if the broad-spectrum CC-chemokine inhibitor "35K" could accelerate wound healing in vivo in mice. In a murine wound healing model, 35K protein or phosphate buffered saline (PBS, control) were added topically daily to wounds. Cohorts of mice were assessed in the early stages (four days post-wounding) and in the later stages of wound repair (10 and 21 days post-wounding). Topical application of the 35K protein inhibited CC-chemokine expression (CCL5, CCL2) in wounds and caused enhanced blood flow recovery and wound closure in early-mid stage wounds. In addition, 35K promoted neovascularisation in the early stages of wound repair. Furthermore, 35K treated wounds had significantly lower expression of the p65 subunit of NF-?B, a key inflammatory transcription factor, and augmented wound expression of the pro-angiogenic and pro-repair cytokine TGF-?. These findings show that broad-spectrum CC-chemokine inhibition may be beneficial for the promotion of wound healing.

| S-EPMC5297788 | biostudies-other

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data