Dataset Information

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

ABSTRACT: We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

SUBMITTER: Suzuki O

PROVIDER: S-EPMC4160947 | biostudies-literature | 2013

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

Suzuki Osamu O Koura Minako M Noguchi Yoko Y Uchio-Yamada Kozue K Matsuda Junichiro J

Experimental animals 20130101 3

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indica ...[more]

PMID: 23903062

Similar Datasets

Project description:BackgroundCurrently very few noninvasive molecular genetic approaches are available to determine zygosity for twin pregnancies in clinical laboratories. This study aimed to develop a novel method to determine zygosity by using maternal plasma target region sequencing.MethodsWe constructed a statistic model to calculate the possibility of each zygosity type using likelihood ratios ( Li ) and empirical dynamic thresholds targeting at 4,524 single nucleotide polymorphisms (SNPs) loci on 22 autosomes. Then two dizygotic (DZ) twin pregnancies,two monozygotic (MZ) twin pregnancies and two singletons were recruited to evaluate the performance of our novel method. Finally we estimated the sensitivity and specificity of the model in silico under different cell-free fetal DNA (cff-DNA) concentration and sequence depth.Results/conclusionsWe obtained 8.90 Gbp sequencing data on average for six clinical samples. Two samples were classified as DZ with L values of 1.891 and 1.554, higher than the dynamic DZ cut-off values of 1.162 and 1.172, respectively. Another two samples were judged as MZ with 0.763 and 0.784 of L values, lower than the MZ cut-off values of 0.903 and 0.918. And the rest two singleton samples were regarded as MZ twins, with L values of 0.639 and 0.757, lower than the MZ cut-off values of 0.921 and 0.799. In silico, the estimated sensitivity of our noninvasive zygosity determination was 99.90% under 10% total cff-DNA concentration with 2 Gbp sequence data. As the cff-DNA concentration increased to 15%, the specificity was as high as 97% with 3.50 Gbp sequence data, much higher than 80% with 10% cff-DNA concentration.SignificanceThis study presents the feasibility to noninvasively determine zygosity of twin pregnancy using target region sequencing, and illustrates the sensitivity and specificity under various detecting condition. Our method can act as an alternative approach for zygosity determination of twin pregnancies in clinical practice.

Dataset Information

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

Publications

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets