Reconvalescent plasma/camostat mesylate in early SARS-CoV-2 Q-PCR positive high-risk individuals (RES-Q-HR): a structured summary of a study protocol for a randomized controlled trial.
Ontology highlight
ABSTRACT:
SUBMITTER: Keitel V
PROVIDER: S-EPMC8127198 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description: Not available
| S-EPMC8041240 | biostudies-literature
Project description:Severe acute respiratory syndrome coronavirus 2 cell entry depends on angiotensin-converting enzyme 2 and transmembrane serine protease 2 and is blocked in cell culture by camostat mesylate, a clinically proven protease inhibitor. Whether camostat mesylate is able to lower disease burden in coronavirus disease 2019 sepsis is currently unknown. Design:Retrospective observational case series. Setting:Patient treated in ICU of University hospital Göttingen, Germany. Patients:Eleven critical ill coronavirus disease 2019 patients with organ failure were treated in ICU. Interventions:Compassionate use of camostat mesylate (six patients, camostat group) or hydroxychloroquine (five patients, hydroxychloroquine group). Measurements and Main Results:Clinical courses were assessed by Sepsis-related Organ Failure Assessment score at days 1, 3, and 8. Further, viral load, oxygenation, and inflammatory markers were determined. Sepsis-related Organ Failure Assessment score was comparable between camostat and hydroxychloroquine groups upon ICU admission. During observation, the Sepsis-related Organ Failure Assessment score decreased in the camostat group but remained elevated in the hydroxychloroquine group. The decline in disease severity in camostat mesylate treated patients was paralleled by a decline in inflammatory markers and improvement of oxygenation. Conclusions:The severity of coronavirus disease 2019 decreased upon camostat mesylate treatment within a period of 8 days and a similar effect was not observed in patients receiving hydroxychloroquine. Camostat mesylate thus warrants further evaluation within randomized clinical trials.
| S-EPMC7671878 | biostudies-literature
Project description:The SARS-CoV-2 coronavirus, which causes COVID-19, uses a viral surface spike protein for host cell entry and the human cell-surface transmembrane serine protease, TMPRSS2, to process the spike protein. Camostat mesylate, an orally available and clinically used serine protease inhibitor, inhibits TMPRSS2, supporting clinical trials to investigate its use in COVID-19. A one-compartment pharmacokinetic (PK)/pharmacodynamic (PD) model for camostat and the active metabolite FOY-251 was developed, incorporating TMPRSS2 reversible covalent inhibition by FOY-251, and empirical equations linking TMPRSS2 inhibition of SARS-CoV-2 cell entry. The model predicts that 95% inhibition of TMPRSS2 is required for 50% inhibition of viral entry efficiency. For camostat 200 mg dosed four times daily, 90% inhibition of TMPRSS2 is predicted to occur but with only about 40% viral entry inhibition. For 3-fold higher camostat dosing, marginal improvement of viral entry rate inhibition, up to 54%, is predicted. Because respiratory tract viral load may be associated with negative outcome, even modestly reducing viral entry and respiratory tract viral load may reduce disease progression. This modeling also supports medicinal chemistry approaches to enhancing PK/PD and potency of the camostat molecule. IMPORTANCE Strategies to repurpose already-approved drugs for the treatment of COVID-19 has been attractive since the beginning of the pandemic. Camostat mesylate, a serine protease inhibitor approved in Japan for the treatment of acute exacerbations of chronic pancreatitis, inhibits TMPRSS1, a host cell surface serine protease essential for SARS-CoV-2 viral entry. In vitro experiments provided data suggesting that camostat might be effective in the treatment of COVID-19. Multiple clinical trials were planned to test the hypothesis that camostat would be beneficial for treating COVID-19 (for example, clinicaltrials.gov, NCT04353284). The present work used a one-compartment pharmacokinetic (PK)/pharmacodynamic (PD) mathematical model for camostat and the active metabolite FOY-251, incorporating TMPRSS2 reversible covalent inhibition by FOY-251, and empirical equations linking TMPRSS2 inhibition of SARS-CoV-2 cell entry. This work is valuable to guide further development of camostat mesylate and possible medicinal chemistry derivatives for the treatment of COVID-19.
| S-EPMC9047529 | biostudies-literature
Project description:BackgroundAntivirals are needed to combat the COVID-19 pandemic, which is caused by SARS-CoV-2. The clinically-proven protease inhibitor Camostat mesylate inhibits SARS-CoV-2 infection by blocking the virus-activating host cell protease TMPRSS2. However, antiviral activity of Camostat mesylate metabolites and potential viral resistance have not been analyzed. Moreover, antiviral activity of Camostat mesylate in human lung tissue remains to be demonstrated.MethodsWe used recombinant TMPRSS2, reporter particles bearing the spike protein of SARS-CoV-2 or authentic SARS-CoV-2 to assess inhibition of TMPRSS2 and viral entry, respectively, by Camostat mesylate and its metabolite GBPA.FindingsWe show that several TMPRSS2-related proteases activate SARS-CoV-2 and that two, TMPRSS11D and TMPRSS13, are robustly expressed in the upper respiratory tract. However, entry mediated by these proteases was blocked by Camostat mesylate. The Camostat metabolite GBPA inhibited recombinant TMPRSS2 with reduced efficiency as compared to Camostat mesylate. In contrast, both inhibitors exhibited similar antiviral activity and this correlated with the rapid conversion of Camostat mesylate into GBPA in the presence of serum. Finally, Camostat mesylate and GBPA blocked SARS-CoV-2 spread in human lung tissue ex vivo and the related protease inhibitor Nafamostat mesylate exerted augmented antiviral activity.InterpretationOur results suggest that SARS-CoV-2 can use TMPRSS2 and closely related proteases for spread in the upper respiratory tract and that spread in the human lung can be blocked by Camostat mesylate and its metabolite GBPA.FundingNIH, Damon Runyon Foundation, ACS, NYCT, DFG, EU, Berlin Mathematics center MATH+, BMBF, Lower Saxony, Lundbeck Foundation, Novo Nordisk Foundation.
| S-EPMC7930809 | biostudies-literature
Project description:Antiviral therapy is urgently needed to combat the coronavirus disease 2019 (COVID-19) pandemic, which is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The protease inhibitor camostat mesylate inhibits SARS-CoV-2 infection of lung cells by blocking the virus-activating host cell protease TMPRSS2. Camostat mesylate has been approved for treatment of pancreatitis in Japan and is currently being repurposed for COVID-19 treatment. However, potential mechanisms of viral resistance as well as camostat mesylate metabolization and antiviral activity of metabolites are unclear. Here, we show that SARS-CoV-2 can employ TMPRSS2-related host cell proteases for activation and that several of them are expressed in viral target cells. However, entry mediated by these proteases was blocked by camostat mesylate. The camostat metabolite GBPA inhibited the activity of recombinant TMPRSS2 with reduced efficiency as compared to camostat mesylate and was rapidly generated in the presence of serum. Importantly, the infection experiments in which camostat mesylate was identified as a SARS-CoV-2 inhibitor involved preincubation of target cells with camostat mesylate in the presence of serum for 2 h and thus allowed conversion of camostat mesylate into GBPA. Indeed, when the antiviral activities of GBPA and camostat mesylate were compared in this setting, no major differences were identified. Our results indicate that use of TMPRSS2-related proteases for entry into target cells will not render SARS-CoV-2 camostat mesylate resistant. Moreover, the present and previous findings suggest that the peak concentrations of GBPA established after the clinically approved camostat mesylate dose (600 mg/day) will result in antiviral activity.
| S-EPMC7418737 | biostudies-literature
Project description:We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.
| S-EPMC4160947 | biostudies-literature
Project description:ObjectivesThis study aimed to assess the efficacy and safety of 300 mg camostat mesylate three times daily in a fasted state to treat early phase COVID-19 in an ambulatory setting.MethodsWe conducted a phase II randomized controlled trial in symptomatic (maximum 5 days) and asymptomatic patients with confirmed COVID-19 infection. Patients were randomly assigned in a 2:1 ratio to receive either camostat mesylate or a placebo. Outcomes included change in nasopharyngeal viral load, time to clinical improvement, the presence of neutralizing antibodies, and safety.ResultsOf 96 participants randomized between November 2020 and June 2021, analyses were performed on the data of 90 participants who completed treatment (N = 61 camostat mesylate, N = 29 placebo). The estimated mean change in cycle threshold between day 1 and day 5 between the camostat and placebo group was 1.183 (P = 0.511). The unadjusted hazard ratio for clinical improvement in the camostat group was 0.965 (95% confidence interval, 0.480-1.942, P = 0.921 by Cox regression). The percentage distribution of the 50% neutralizing antibody titer at day 28 visit and frequency of adverse events were similar between the two groups.ConclusionUnder this protocol, camostat mesylate was not found to be effective as an antiviral drug against SARS-CoV-2.Trial registrationClinicalTrials.gov NCT04625114; November 12, 2020.
| S-EPMC9254441 | biostudies-literature
Project description:Cowden syndrome results from germline mutations in the gene for phosphatase and tensin homologue deleted on chromosome 10 (PTEN) and from variants in succinate dehydrogenase B and D subunits. We hypothesized that succinate accumulation may be common among individuals with SDH variants/mutations and those with PTEN mutations.Urine and blood were collected from individuals meeting full or partial Cowden syndrome diagnostic criteria or those with paraganglioma (PGL) or a known susceptibility paraganglioma-associated gene mutation, and succinate was measured. PTEN, SDHB, SDHC, and SDHD genes were sequenced from genomic DNA.Elevated plasma succinate was observed in 13/21 (62%) individuals with germline PTEN, SDHB, or SDHD mutations as compared with 5/32 (16%) controls (P < 0.001), in 10/15 (67%) individuals with pathogenic PTEN mutations but in <20% of mutation-negative individuals meeting identical criteria, and in individuals with mutations in SDHB (1/1, 100%) and SDHD (2/5, 40%).Our data suggest that mutations in PTEN, SDHB, and SDHD reduce catalytic activity of succinate dehydrogenase, resulting in succinate accumulation, and identify a common biochemical alteration in these two patient populations (PTEN and SDHx mutation positive individuals). Plasma organic acid analysis may provide an effective and inexpensive screening method to determine when more expensive gene sequencing of PTEN and SDH genes is warranted.
| S-EPMC4019996 | biostudies-literature
Project description:BACKGROUND: Summary measures of health that combine mortality and morbidity into a single indicator are being estimated in the Canadian context for approximately 200 diseases and conditions. To manage the large amount of data and calculations for this many diseases, we have developed a structured workbook system with easy to use tools. We expect this system will be attractive to researchers from other countries or regions of Canada who are interested in estimating the health-adjusted life years (HALYs) lost to premature mortality and year-equivalents lost to reduced functioning, as well as population attributable fractions (PAFs) associated with risk factors. This paper describes the workbook system using cancers as an example, and includes the entire system as a free, downloadable package. METHODS: The workbook system was developed in Excel and runs on a personal computer. It is a database system that stores data on population structure, mortality, incidence, distributions of cases entering a multitude of health states, durations of time spent in health states, preference scores that weight for severity, life table estimates of life expectancies, and risk factor prevalence and relative risks. The tools are Excel files with embedded macro programs. The main tool generates workbooks that estimate HALY, one per disease, by copying data from the database into a pre-defined template. Other tools summarize the HALY results across diseases for easy analysis. RESULTS: The downloadable zip file contains the database files initialized with Canadian data for cancers, the tools, templates and workbooks that estimate PAF and a user guide. The workbooks that estimate HALY are generated from the system at a rate of approximately one minute per disease. The resulting workbooks are self-contained and can be used directly to explore the details of a particular disease. Results can be discounted at different rates through simple parameter modification. CONCLUSION: The structured workbook approach offers researchers an efficient, easy to use, and easy to understand set of tools for estimating HALY and PAF summary measures for their country or region of interest.
| S-EPMC1156945 | biostudies-literature
Project description:The search for clinically effective antivirals against the severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) is ongoing. Repurposing of drugs licensed for non-coronavirus disease 2019 (COVID-19) indications has been extensively investigated in laboratory models and in clinical studies with mixed results. Nafamostat mesylate (nafamostat) is a drug licensed in Japan and Korea for indications including acute pancreatitis and disseminated intravascular coagulation. It is available only for continuous intravenous infusion. In vitro human lung cell line studies with nafamostat demonstrate high antiviral potency against SARS-CoV-2 (half maximal inhibitory concentration [IC50] of 0.0022 µM [compared to remdesivir 1.3 µM]), ostensibly via inhibition of the cellular enzyme transmembrane protease serine 2 (TMPRSS2) preventing viral entry into human cells. In addition, the established antithrombotic activity is hypothesised to be advantageous given thrombosis-associated sequelae of COVID-19. Clinical reports to date are limited, but indicate a potential benefit of nafamostat in patients with moderate to severe COVID-19. In this review, we will explore the pre-clinical, pharmacokinetic and clinical outcome data presently available for nafamostat as a treatment for COVID-19. The recruitment to ongoing clinical trials is a priority to provide more robust data on the safety and efficacy of nafamostat as a treatment for COVID-19.
| S-EPMC9425784 | biostudies-literature