A family with Milroy disease caused by the FLT4/VEGFR3 gene variant c.2774 T > A.
Ontology highlight
ABSTRACT: Background
Milroy disease (MD) is a rare, autosomal-dominant disorder. Variants in the Fms-related tyrosine kinase 4 (FLT4/VEGFR3) gene cause the symptoms of this disease. In this report, we investigated the variant in a large Chinese family with MD.Methods
We conducted Sanger sequencing of exons 17-26 of FLT4/VEGFR3 (NM_182925.4). We assessed its pathogenicity based on the ACMG criteria and predicted it with an in silico program.Results
A heterozygous substitution (NM_182925.4 (FLT4/VEGFR3):c.2774 T>A, p. (Val925Glu)) was detected in all patients with MD but not in any healthy controls. The variant was evaluated as pathogenic according to the ACMG criteria and was predicted to be pathogenic using an in silico program.Conclusions
In this report, we described a large family with MD caused by a missense variant in FLT4/VEGFR3 (NM_182925.4 (FLT4/VEGFR3_v001):c.2774 T>A, p. (Val925Glu)). There are phenotypic heterogeneities among family members, and further research should be conducted to explore the possible reasons.
SUBMITTER: Sui Y
PROVIDER: S-EPMC8186030 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:The molecular mechanisms initiating the formation of the lymphatic system, lymphangiogenesis, are still poorly understood. Here we have identified a novel role in lymphangiogenesis for an ETS transcription factor, Etv2/Etsrp, a known regulator of embryonic vascular development. Through the use of fully validated photoactivatable morpholinos we show that inducible Etv2 inhibition in zebrafish embryos at 1?day post-fertilization (dpf) results in significant inhibition of lymphangiogenesis, while development of blood vessels is unaffected. In Etv2-inhibited embryos and larvae, the number of lymphatic progenitors is greatly reduced, the major lymphatic vessel, the thoracic duct, is absent or severely fragmented, and lymphangiogenesis-associated marker expression, including lyve1b, prox1a, and vegfr3/flt4, is strongly downregulated. We also demonstrate that lymphatic progenitors in Etv2 deficient embryos fail to respond to Vegfc signaling. Chromatin immunoprecipitation and sequencing (ChIP-Seq) studies using differentiated mouse embryonic stem (ES) cells as well as luciferase reporter studies in the ES cells and in zebrafish embryos argue that Etv2 directly binds the promoter/enhancer regions of Vegfc receptor Vegfr3/Flt4 and lymphatic marker Lyve1, and promotes their expression. Together these data support a model where Etv2 initiates lymphangiogenesis by directly promoting the expression of flt4 within the posterior cardinal vein.
| S-EPMC6054491 | biostudies-literature
Project description:We present the first case of a Japanese patient with familial hypobetalipoproteinemia (FHBL) caused by a protein-truncating variant in the proprotein convertase subtilisin/kexin type 9 (PCSK9) gene. A 34-year-old woman was referred to our hospital due to her low low-density lipoprotein (LDL)-cholesterolemia (34 mg/dL). She did not have any secondary causes of hypobetalipoproteinemia. Her father and her younger sister also exhibited low LDL cholesterol levels. We identified a protein-truncating variant in the PCSK9 gene (c.1090_1091del/p.Pro364ArgfsTer62) among them. None of them exhibited atherosclerotic cardiovascular diseases nor any other complications associated with low LDL cholesterol, including fatty liver, neurocognitive disorders, or cerebral hemorrhaging.
| S-EPMC7118388 | biostudies-literature
Project description:Hereditary lymphedema is a chronic swelling of limbs due to dysfunction of lymphatic vessels. An autosomal dominant, congenital form of the disease, also known as "Milroy disease," has been mapped to the telomeric part of chromosome 5q, in the region 5q34-q35. This region contains a good candidate gene for the disease, VEGFR3 (FLT4), that encodes a receptor tyrosine kinase specific for lymphatic vessels. To clarify the role of VEGFR3 in the etiology of the disease, we have analyzed a family with hereditary lymphedema. We show linkage of the disease with markers in 5q34-q35, including a VEGFR3 intragenic polymorphism, and we describe an A-->G transition that cosegregates with the disease, corresponding to a histidine-to-arginine substitution in the catalytic loop of the protein. In addition, we show, by in vitro expression, that this mutation inhibits the autophosphorylation of the receptor. Thus, defective VEGFR3 signaling seems to be the cause of congenital hereditary lymphedema linked to 5q34-q35.
| S-EPMC1287178 | biostudies-literature
Project description:BACKGROUND:Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS:We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS:Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION:Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.
| S-EPMC6929446 | biostudies-literature
Project description:BACKGROUND:Classifying pathogenicity of missense variants represents a major challenge in clinical practice during the diagnoses of rare and genetic heterogeneous neurodevelopmental disorders (NDDs). While orthologous gene conservation is commonly employed in variant annotation, approximately 80% of known disease-associated genes belong to gene families. The use of gene family information for disease gene discovery and variant interpretation has not yet been investigated on a genome-wide scale. We empirically evaluate whether paralog-conserved or non-conserved sites in human gene families are important in NDDs. METHODS:Gene family information was collected from Ensembl. Paralog-conserved sites were defined based on paralog sequence alignments; 10,068 NDD patients and 2078 controls were statistically evaluated for de novo variant burden in gene families. RESULTS:We demonstrate that disease-associated missense variants are enriched at paralog-conserved sites across all disease groups and inheritance models tested. We developed a gene family de novo enrichment framework that identified 43 exome-wide enriched gene families including 98 de novo variant carrying genes in NDD patients of which 28 represent novel candidate genes for NDD which are brain expressed and under evolutionary constraint. CONCLUSION:This study represents the first method to incorporate gene family information into a statistical framework to interpret variant data for NDDs and to discover new NDD-associated genes.
| S-EPMC7079346 | biostudies-literature
Project description:BackgroundThe aim of the study was to identify the molecular genetic cause of two different Mendelian traits with ocular involvement present in the members of a single consanguineous Czech Roma family.MethodsWe have performed ocular examination and review of medical records in two individuals diagnosed with nanophthalmos (proband and her father) and one individual followed for bilateral congenital cataract and microcornea (uncle of the proband). DNA of subjects with nanophthalmos was analysed by exome sequencing. Sanger sequencing was applied for targeted screening of potentially pathogenic variants and to follow segregation of identified variants within the family.ResultsA homozygous variant c.1509G>C; p.(Met503Ile), in PRSS56 was found in the two individuals affected with nanophthalmos. The change was absent from the gnomAD dataset, but two out of 118 control Roma individuals were also shown to be heterozygous carriers. Analysis of single nucleotide polymorphisms in linkage disequilibrium with the c.1509G>C in PRSS56 suggested a shared chromosomal segment. The nanophthalmos phenotype, characterized in detail in the younger individual, encompassed bilateral corneal steepening, retinal folds, buried optic head drusen, and restricted visual fields, but no signs of retinal dystrophy. A known pathogenic founder CTDP1 variant c.863+389C>T in a homozygous state was identified in the other family member confirming the suspected diagnosis of congenital cataracts, facial dysmorphism, and demyelinating neuropathy syndrome.ConclusionsHerein, we report the first occurrence of nanophthalmos in the Roma population. We have identified pseudodominant inheritance for this phenotype caused by a novel variant in PRSS56, representing a possible founder effect. Despite advances in genetic technologies such as exome sequencing, careful phenotype evaluation in patients from an isolated population, along with an awareness of population-specific founder effects, is necessary to ensure that accurate molecular diagnoses are made.
| S-EPMC7212339 | biostudies-literature
Project description:PurposeUGT1A1, UGT2B7, and UGT2B15 are well-known pharmacogenes that belong to the uridine diphosphate glucuronyltransferase gene family. For personalized drug treatment, it is important to study differences in the frequency of core markers across various ethnic groups. Accordingly, we screened single nucleotide polymorphisms (SNPs) of these three genes and analyzed differences in their frequency among five ethnic groups, as well as attempted to predict the function of novel SNPs.Materials and methodsWe directly sequenced 288 subjects consisting of 96 Korean, 48 Japanese, 48 Han Chinese, 48 African American, and 48 European American subjects. Subsequently, we analyzed genetic variability, linkage disequilibrium (LD) structures and ethnic differences for each gene. We also conducted in silico analysis to predict the function of novel SNPs.ResultsA total of 87 SNPs were detected, with seven pharmacogenetic core SNPs and 31 novel SNPs. We observed that the frequencies of UGT1A1 *6 (rs4148323), UGT1A1 *60 (rs4124874), UGT1A1 *93 (rs10929302), UGT2B7 *2 (rs7439366), a part of UGT2B7 *3 (rs12233719), and UGT2B15 *2 (rs1902023) were different between Asian and other ethnic groups. Additional in silico analysis results showed that two novel promoter SNPs of UGT1A1 -690G>A and -689A>C were found to potentially change transcription factor binding sites. Moreover, 673G>A (UGT2B7), 2552T>C, and 23269C>T (both SNPs from UGT2B15) changed amino acid properties, which could cause structural deformation.ConclusionFindings from the present study would be valuable for further studies on pharmacogenetic studies of personalized medicine and drug response.
| S-EPMC3874916 | biostudies-literature
Project description:Objective:We report 3 siblings with the characteristic features of ataxia-telangiectasia-like disorder associated with a homozygous MRE11 synonymous variant causing nonsense-mediated mRNA decay (NMD) and MRE11A deficiency. Methods:Clinical assessments, next-generation sequencing, transcript and immunohistochemistry analyses were performed. Results:The patients presented with poor balance, developmental delay during the first year of age, and suffered from intellectual disability from early childhood. They showed oculomotor apraxia, slurred and explosive speech, limb and gait ataxia, exaggerated deep tendon reflex, dystonic posture, and mirror movement in their hands. They developed mild cognitive abilities. Brain MRI in the index case revealed cerebellar atrophy. Next-generation sequencing revealed a homozygous synonymous variant in MRE11 (c.657C>T, p.Asn219=) that we show affects splicing. A complete absence of MRE11 transcripts in the index case suggested NMD and immunohistochemistry confirmed the absence of a stable protein. Conclusions:Despite the critical role of MRE11A in double-strand break repair and its contribution to the Mre11/Rad50/Nbs1 complex, the absence of MRE11A is compatible with life.
| S-EPMC6283458 | biostudies-literature
Project description:Cerebral cavernous malformations (CCMs) are common vascular malformations in the central nervous system. Familial CCMs (FCCMs) are autosomal dominant inherited disease with incomplete penetrance and variable symptoms. Mutations in the KRIT1, CCM2, and PDCD10 genes cause the development of FCCM. Approximately 476 mutations of three CCM-related genes have been reported, most of which were case reports, and lack of data in stable inheritance. In addition, only a small number of causative missense mutations had been identified in patients. Here, we reported that 8/20 members of a Chinese family were diagnosed with CCMs. By direct DNA sequencing, we found a novel variant c.331G > C (p.A111P) in exon 4 of the CCM2 gene, which was a heterozygous exonic variant, in 7/20 family members. We consider this variant to be causative of disease due to a weaken the protein-protein interaction between KRIT1 and CCM2. In addition, we also found the exon 13 deletion in KRIT1 coexisting with the CCM2 mutation in patient IV-2, and this was inherited from her father (patient III-1H). This study of a Chinese family with a large number of patients with CCMs and stable inheritance of a CCM2 mutation contributes to better understanding the spectrum of gene mutations in CCMs.
| S-EPMC7813800 | biostudies-literature
Project description:Rare genetic variants are thought to be important components in the causality of many diseases but discovering these associations is challenging. We demonstrate how best to use family-based designs to improve the power to detect rare variant disease associations. We show that using genetic data from enriched families (those pedigrees with greater than one affected member) increases the power and sensitivity of existing case-control rare variant tests. However, we show that transmission- (or within-family-) based tests do not benefit from this enrichment. This means that, in studies where a limited amount of genotyping is available, choosing a single case from each of many pedigrees has greater power than selecting multiple cases from fewer pedigrees. Finally, we show how a pseudo-case-control design allows a greater range of statistical tests to be applied to family data.
| S-EPMC4292528 | biostudies-literature