Browse
Submit Data
Databases
API
Help

Dataset Information

25 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Applying Cryo-X-ray Photoelectron Spectroscopy to Study the Surface Chemical Composition of Fungi and Viruses.

ABSTRACT: Interaction between microorganisms and their surroundings are generally mediated via the cell wall or cell envelope. An understanding of the overall chemical composition of these surface layers may give clues on how these interactions occur and suggest mechanisms to manipulate them. This knowledge is key, for instance, in research aiming to reduce colonization of medical devices and device-related infections from different types of microorganisms. In this context, X-ray photoelectron spectroscopy (XPS) is a powerful technique as its analysis depth below 10 nm enables studies of the outermost surface structures of microorganism. Of specific interest for the study of biological systems is cryogenic XPS (cryo-XPS). This technique allows studies of intact fast-frozen hydrated samples without the need for pre-treatment procedures that may cause the cell structure to collapse or change due to the loss of water. Previously, cryo-XPS has been applied to study bacterial and algal surfaces with respect to their composition of lipids, polysaccharides and peptide (protein and/or peptidoglycan). This contribution focuses onto two other groups of microorganisms with widely different architecture and modes of life, namely fungi and viruses. It evaluates to what extent existing models for data treatment of XPS spectra can be applied to understand the chemical composition of their very different surface layers. XPS data from model organisms as well as reference substances representing specific building blocks of their surface were collected and are presented. These results aims to guide future analysis of the surface chemical composition of biological systems.

SUBMITTER: Shchukarev A

PROVIDER: S-EPMC8194281 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Effective attenuation lengths for quantitative determination of surface composition by Auger-electron spectroscopy and X-ray photoelectron spectroscopy.

Project description:The effective attenuation length (EAL) is normally used in place of the inelastic mean free path (IMFP) to account for elastic-scattering effects when describing the attenuation of Auger electrons and photoelectrons from a planar substrate by an overlayer film. An EAL for quantitative determination of surface composition by Auger-electron spectroscopy (AES) or X-ray photoelectron spectroscopy (XPS) is similarly useful to account for elastic-scattering effects on the signal intensities. We calculated these EALs for four elemental solids (Si, Cu, Ag, and Au) and for energies between 160 eV and 1.4 keV. The XPS calculations were made for two instrumental configurations while the AES calculations were made from the XPS formalism after "switching off" the XPS anisotropy. The EALs for quantitative determination of surface composition by AES and XPS were weak functions of emission angle for emission angles between 0 and 50°. The ratios of the average values of these EALs to the corresponding IMFPs could be fitted to a second-order function of the single-scattering albedo, a convenient measure of the strength of elastic-scattering effects. EALs for quantitative determination of surface composition by AES and XPS for other materials can be simply found from this relationship.

| S-EPMC5729791 | biostudies-literature

Relating X-ray photoelectron spectroscopy data to chemical bonding in MXenes.

Project description:The relationship between core level binding energy shifts (ΔCLBEs), that can be experimentally determined by X-ray photoelectron spectroscopy, and chemical bonding is analyzed for a series of MXenes, a new family of two-dimensional materials with a broad number of applications in nanotechnology. Based on first-principles calculations, the atomic and electronic structure of bare and O-terminated carbide MXene with M2C and M2CO2 (M = Ti, Zr, Hf, V, Nb, Ta, Cr, Mo, and W) stoichiometries are investigated with a focus on trends in the C(1s) and O(1s) ΔCLBEs, including initial and final state effects, along with the series. A rather good linear correlation between the available experimental and calculated C(1s) and O(1s) ΔCLBEs exists, with quantitative agreement when final state effects are included, that validates the conclusions from the present computational approach. The present study shows that ΔCLBEs of bare MXenes are governed by the initial state effects and directly correlate with the net charge on the C atoms. However, for the case of O-terminated MXenes, C(1s) and O(1s) ΔCLBEs exhibit a much less significant correlation with the net charge of either C or O atoms which is attributed to the structural changes induced on the M2C moiety by the presence of the O layers and the different stacking sequence observed depending on the MXene composition. The present study shows how and when XPS can be used to extract information regarding the nature of the chemical bond in bare or functionalized MXenes.

| S-EPMC9418319 | biostudies-literature

Following excited-state chemical shifts in molecular ultrafast x-ray photoelectron spectroscopy.

Project description:The conversion of photon energy into other energetic forms in molecules is accompanied by charge moving on ultrafast timescales. We directly observe the charge motion at a specific site in an electronically excited molecule using time-resolved x-ray photoelectron spectroscopy (TR-XPS). We extend the concept of static chemical shift from conventional XPS by the excited-state chemical shift (ESCS), which is connected to the charge in the framework of a potential model. This allows us to invert TR-XPS spectra to the dynamic charge at a specific atom. We demonstrate the power of TR-XPS by using sulphur 2p-core-electron-emission probing to study the UV-excited dynamics of 2-thiouracil. The method allows us to discover that a major part of the population relaxes to the molecular ground state within 220-250 fs. In addition, a 250-fs oscillation, visible in the kinetic energy of the TR-XPS, reveals a coherent exchange of population among electronic states.

| S-EPMC8752854 | biostudies-literature

Surface Termination Conversion during SrTiO3 Thin Film Growth Revealed by X-ray Photoelectron Spectroscopy.

Project description:Emerging electrical and magnetic properties of oxide interfaces are often dominated by the termination and stoichiometry of substrates and thin films, which depend critically on the growth conditions. Currently, these quantities have to be measured separately with different sophisticated techniques. This report will demonstrate that the analysis of angle dependent X-ray photoelectron intensity ratios provides a unique tool to determine both termination and stoichiometry simultaneously in a straightforward experiment. Fitting the experimental angle dependence with a simple analytical model directly yields both values. The model is calibrated through the determination of the termination of SrTiO3 single crystals after systematic pulsed laser deposition of sub-monolayer thin films of SrO. We then use the model to demonstrate that during homoepitaxial SrTiO3 growth, excess Sr cations are consumed in a self-organized surface termination conversion before cation defects are incorporated into the film. We show that this termination conversion results in insulating properties of interfaces between polar perovskites and SrTiO3 thin films. These insights about oxide thin film growth can be utilized for interface engineering of oxide heterostructures. In particular, they suggest a recipe for obtaining two-dimensional electron gases at thin film interfaces: SrTiO3 should be deposited slightly Ti-rich to conserve the TiO2-termination.

| S-EPMC4507138 | biostudies-literature

Water-polyamide chemical interplay in desalination membranes explored by ambient pressure X-ray photoelectron spectroscopy.

Project description:Reverse osmosis using aromatic polyamide membranes is currently the most important technology for seawater desalination. The performance of reverse osmosis membranes is highly dependent on the interplay of their surface chemical groups with water and water contaminants. In order to better understand the underlying mechanisms of these membranes, we study ultrathin polyamide films that chemically resemble reverse osmosis membranes, using ambient pressure X-ray photoelectron spectroscopy. This technique can identify the functional groups at the membrane-water interface and allows monitoring of small shifts in the electron binding energy that indicate interaction with water. We observe deprotonation of free acid groups and formation of a 'water complex' with nitrogen groups in the polymer upon exposure of the membrane to water vapour. The chemical changes are reversed when water is removed from the membrane. While the correlation between functional groups and water uptake is an established one, this experiment serves to understand the nature of their chemical interaction, and opens up possibilities for tailoring future materials to specific requirements.

| S-EPMC7671007 | biostudies-literature

Nanostructured spinel cobalt ferrites: Fe and Co chemical state, cation distribution and size effects by X-ray photoelectron spectroscopy.

Project description:Nanostructured spinel cobalt ferrite samples having crystallite size ranging between 5.6 and 14.1 nm were characterized by X-ray photoelectron spectroscopy and X-ray induced Auger electron spectroscopy in order to determine the chemical state of the elements, the iron/cobalt ratio and the cation distribution within tetrahedral and octahedral sites. The presence of size-dependent trends in the binding energy of the main photoelectron peaks and in the kinetic energy of the X-ray induced O KLL signal was also investigated. The results showed that iron is present as FeIII and cobalt is present as CoII. The iron/cobalt ratio determined by XPS ranges between 1.8 and 1.9 and it is in very good agreement, within experimental uncertainty, with the expected 2 : 1 ratio. The percentage of Fe in octahedral sites ranges between 62% and 64% for all samples. The kinetic energy of the O KLL signals increases with crystallite size. These results are explained in terms of changes in the ionicity of the metal-oxygen bonds. The results of this investigation highlight how the XPS technique represents a powerful tool to investigate the composition, the chemical state and inversion degree of cobalt spinel ferrites, contributing to the comprehension of their properties.

| S-EPMC9128503 | biostudies-literature

Composition, thickness, and homogeneity of the coating of core-shell nanoparticles-possibilities, limits, and challenges of X-ray photoelectron spectroscopy.

Project description:Core-shell nanoparticles have attracted much attention in recent years due to their unique properties and their increasing importance in many technological and consumer products. However, the chemistry of nanoparticles is still rarely investigated in comparison to their size and morphology. In this review, the possibilities, limits, and challenges of X-ray photoelectron spectroscopy (XPS) for obtaining more insights into the composition, thickness, and homogeneity of nanoparticle coatings are discussed with four examples: CdSe/CdS quantum dots with a thick coating and a small core; NaYF4-based upconverting nanoparticles with a large Yb-doped core and a thin Er-doped coating; and two types of polymer nanoparticles with a poly(tetrafluoroethylene) core with either a poly(methyl methacrylate) or polystyrene coating. Different approaches for calculating the thickness of the coating are presented, like a simple numerical modelling or a more complex simulation of the photoelectron peaks. Additionally, modelling of the XPS background for the investigation of coating is discussed. Furthermore, the new possibilities to measure with varying excitation energies or with hard-energy X-ray sources (hard-energy X-ray photoelectron spectroscopy) are described. A discussion about the sources of uncertainty for the determination of the thickness of the coating completes this review. Graphical abstract.

| S-EPMC9142455 | biostudies-literature

X-ray photoelectron spectroscopy and infrared spectroscopy study of maleimide-activated supports for immobilization of oligodeoxyribonucleotides.

Project description:Surface-tethered nucleic acids are widely applied in solid-phase assays in which complementary strands must be detected against a complex mixture of other sequences. In response to such needs, numerous methods have been developed for immobilizing nucleic acids on solid supports. Often, detailed analysis of associated chemical transformations and of potential side reactions is difficult to obtain. Combined use of planar and high surface area powder supports allows characterization using surface as well as bulk diagnostic techniques. This approach is followed in the present study in which X-ray photoelectron spectroscopy (XPS), transmission infrared spectroscopy (FTIR) and reactivity titrations are used to investigate siliceous supports modified with an aminosilane precursor followed by a maleimide-bearing crosslinker for attachment of nucleic acids. The supports retain maleimide activity for approximately a day when stored under buffer, but deactivation is accelerated under basic conditions or by incomplete conversion of the precursor aminosilane monolayer. Reactions involving the olefinic bond of the imide as well as its carbonyl groups are observed and analyzed. Attachment of sulfhydryl-terminated oligodeoxyribonucleotides is highly site specific, and immobilized strands exhibit excellent hybridization activity. Quantitative use of XPS for label-free determination of DNA coverage based on calibration against reference materials is also described.

| S-EPMC534618 | biostudies-literature

Valence and Core-Level X-ray Photoelectron Spectroscopy of a Liquid Ammonia Microjet.

Project description:Photoelectron spectroscopy of microjets expanded into vacuum allows access to orbital energies for solute or solvent molecules in the liquid phase. Microjets of water, acetonitrile and alcohols have previously been studied; however, it has been unclear whether jets of low temperature molecular solvents could be realized. Here we demonstrate a stable 20 μm jet of liquid ammonia (-60 °C) in a vacuum, which we use to record both valence and core-level band photoelectron spectra using soft X-ray synchrotron radiation. Significant shifts from isolated ammonia in the gas-phase are observed, as is the liquid-phase photoelectron angular anisotropy. Comparisons with spectra of ammonia in clusters and the solid phase, as well as spectra for water in various phases potentially reveal how hydrogen bonding is reflected in the condensed phase electronic structure.

| S-EPMC6728086 | biostudies-literature

Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL.

Project description:The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

| S-EPMC3485869 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data