A Nanoscale Metal-Organic Framework to Mediate Photodynamic Therapy and Deliver CpG Oligodeoxynucleotides to Enhance Antigen Presentation and Cancer Immunotherapy.
Ontology highlight
ABSTRACT:
SUBMITTER: Ni K
PROVIDER: S-EPMC8253508 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:Immunotherapy has become a promising cancer therapy, but only works for a subset of cancer patients. Immunogenic photodynamic therapy (PDT) can prime cancer immunotherapy to increase the response rates, but its efficacy is severely limited by tumor hypoxia. Here we report a nanoscale metal-organic framework, Fe-TBP, as a novel nanophotosensitizer to overcome tumor hypoxia and sensitize effective PDT, priming non-inflamed tumors for cancer immunotherapy. Fe-TBP was built from iron-oxo clusters and porphyrin ligands and sensitized PDT under both normoxic and hypoxic conditions. Fe-TBP mediated PDT significantly improved the efficacy of anti-programmed death-ligand 1 (?-PD-L1) treatment and elicited abscopal effects in a mouse model of colorectal cancer, resulting in >90% regression of tumors. Mechanistic studies revealed that Fe-TBP mediated PDT induced significant tumor infiltration of cytotoxic T cells.
| S-EPMC6533908 | biostudies-literature
Project description:Checkpoint blockade immunotherapy (CBI) elicits durable therapeutic responses by blocking T cell inhibitory pathways of tumors with pre-infiltrated T cells and/or high mutational burden to activate antitumor immunity but is ineffective against poorly immunogenic tumors. Immunogenic radiotherapy, photodynamic therapy (PDT), and chemotherapy have thus been examined as immunomodulatory adjuvants to augment CBI. Dysregulated hormone production has long been linked to tumorigenesis and poor prognosis of various cancers. Herein, we report the use of a Cu-porphyrin nanoscale metal-organic framework (nMOF) to mediate synergistic hormone-triggered chemodynamic therapy (CDT) and light-triggered PDT. The combination of CDT/PDT-based radical therapy with a programmed cell-death ligand 1 blockade effectively extends the local therapeutic effects of CDT/PDT to distant tumors via abscopal effects on mouse tumor models with high levels of estradiol. Our work thus establishes the feasibility of combining nMOF-mediated radical therapy with CBI to elicit systemic antitumor immunity in hormonally dysregulated tumor phenotypes.
| S-EPMC6681452 | biostudies-literature
Project description:Photodynamic therapy (PDT) can destroy local tumors and minimize normal tissue damage, but is ineffective at eliminating metastases. Checkpoint blockade immunotherapy has enjoyed recent success in the clinic, but only elicits limited rates of systemic antitumor response for most cancers due to insufficient activation of the host immune system. Here we describe a treatment strategy that combines PDT by a new chlorin-based nanoscale metal-organic framework (nMOF), TBC-Hf, and a small-molecule immunotherapy agent that inhibits indoleamine 2,3-dioxygenase (IDO), encapsulated in the nMOF channels to induce systemic antitumor immunity. The synergistic combination therapy achieved effective local and distant tumor rejection in colorectal cancer models. We detected increased T cell infiltration in the tumor microenvironment after activation of the immune system with the combination of IDO inhibition by the small-molecule immunotherapy agent and immunogenic cell death induced by PDT. We also elucidated the underlying immunological mechanisms and revealed compensatory roles of neutrophils and B cells in presenting tumor-associated antigens to T cells in this combination therapy. We believe that nMOF-enabled PDT has the potential to significantly enhance checkpoint blockade cancer immunotherapy, affording clinical benefits for the treatment of many difficult-to-treat cancers.
| S-EPMC5673483 | biostudies-literature
Project description:The performance of photodynamic therapy (PDT) depends on the solubility, pharmacokinetic behaviors, and photophysical properties of photosensitizers (PSs). However, highly conjugated PSs with strong reactive oxygen species (ROS) generation efficiency tend to have poor solubility and aggregate in aqueous environments, leading to suboptimal PDT performance. Here, we report a new strategy to load highly conjugated but poorly soluble zinc-phthalocyanine (ZnP) PSs in the pores of a Hf12-QC (QC = 2″,3'-dinitro-[1,1':4',1";4″,1'"-quaterphenyl]-4,4'"-dicarboxylate) nanoscale metal-organic framework to afford ZnP@Hf-QC with spatially confined ZnP PSs. ZnP@Hf-QC avoids aggregation-induced quenching of ZnP excited states to significantly enhance ROS generation upon light irradiation. With higher cellular uptake, enhanced ROS generation, and better biocompatibility, ZnP@Hf-QC mediated PDT exhibited an IC50 of 0.14 μM and achieved exceptional antitumor efficacy with >99% tumor growth inhibition and 80% cure rates on two murine colon cancer models.
| S-EPMC8414475 | biostudies-literature
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:Tuberculosis (TB) is an infectious disease caused by Mycobacterium tuberculosis (Mtb) that poses a serious global public health threat. Due to the high incidence of adverse reactions associated with conventional treatment regimens, there is an urgent need for better alternative therapies. CpG oligodeoxynucleotides (CpG ODNs) are synthetic oligodeoxyribonucleotide sequences. They can induce a Th1-type immune response by stimulating Toll-like receptors (TLRs) in mammalian immune cells, thus killing Mtb. However, due to the negative charge and easy degradation of CpG ODNs, it is necessary to deliver them into cells using nanomaterials. PCN-224 (hereinafter referred to as PCN), as a metal-organic framework based on zirconium ions and porphyrin ligands, not only has the advantage of high drug loading capacity, but also the porphyrin molecule in it is a type of photosensitizer, which allows these nanocomposites to play a role in photodynamic therapy (PDT) while delivering CpG ODNs. In addition, since Mtb mainly exists in macrophages, targeting anti-TB agents to macrophages is helpful to improve the anti-TB effect. Phosphatidylserine (PS) is a biological membrane phospholipid that is normally found on the inner side of cell membranes in, for example, plant and mammalian cells. When apoptosis occurs, PS can flip from the inner side of the cell membrane to the surface of the cell membrane, displaying a specific "eat-me" signal that can be recognized by specific receptors on macrophages. Therefore, we can use this macrophage-targeting property of PS to construct bio-inspired targeted drug delivery systems. In this study, we constructed PCN-CpG@PS nanocomposites. PCN-CpG@PS, combining PDT and immunotherapy, is designed to target macrophages at the site of a lesion and kill latent Mtb. We physically characterized the nanocomposites and validated their bactericidal ability in vitro and their ability to stimulate the immune system in vivo. The results demonstrated that the targeted nanocomposites have certain in vitro antituberculosis efficacy with good safety.
| S-EPMC9832440 | biostudies-literature
Project description:We report here the rational design of the first chlorin-based nanoscale metal-organic framework (NMOF), DBC-UiO, with much improved photophysical properties over the previously reported porphyrin-based NMOF, DBP-UiO. Reduction of the DBP ligands in DBP-UiO to the DBC ligands in DBC-UiO led to a 13 nm red shift and an 11-fold increase in the extinction coefficient of the lowest-energy Q band. While inheriting the crystallinity, stability, porosity, and nanoplate morphology of DBP-UiO, DBC-UiO sensitizes more efficient (1)O2 generation and exhibits significantly enhanced photodynamic therapy (PDT) efficacy on two colon cancer mouse models as a result of its improved photophysical properties. Both apoptosis and immunogenic cell death contributed to killing of cancer cells in DBC-UiO-induced PDT.
| S-EPMC4691355 | biostudies-literature
Project description:Checkpoint blockade immunotherapy enhances systemic antitumor immune response by targeting T cell inhibitory pathways; however, inadequate T cell infiltration has limited its anticancer efficacy. Radiotherapy (RT) has local immunomodulatory effects that can alter the microenvironment of irradiated tumors to synergize with immune checkpoint blockade. However, even with high doses of radiation, RT has rarely elicited systemic immune responses. Herein, we report the design of two porous Hf-based nanoscale metal-organic frameworks (nMOFs) as highly effective radioenhancers that significantly outperform HfO2, a clinically investigated radioenhancer in vitro and in vivo. Importantly, the combination of nMOF-mediated low-dose RT with an anti-programmed death-ligand 1 antibody effectively extends the local therapeutic effects of RT to distant tumors via abscopal effects. Our work establishes the feasibility of combining nMOF-mediated RT with immune checkpoint blockade to elicit systemic antitumor immunity in non-T cell-inflamed tumor phenotypes without normal tissue toxicity, promising to broaden the application of checkpoint blockade immunotherapy.
| S-EPMC6003951 | biostudies-literature
Project description:CpG-oligodeoxynucleotides (CpG-ODNs) are potent immune stimuli currently under investigation as antimicrobial agents for different species. Toll-like receptor (TLR) 9 and TLR21 are the cellular receptors of CpG-ODN in mammals and chickens, respectively. The avian genomes lack TLR9, whereas mammalian genomes lack TLR21. Although fish contain both of these genes, the biological functions of fish TLR9 and TLR21 have not been investigated previously. In this study, we comparatively investigated zebrafish TLR9 (zebTLR9) and TLR21 (zebTLR21). The two TLRs have similar expression profiles in zebrafish. They are expressed during early development stages and are preferentially expressed in innate immune function-related organs in adult fish. Results from cell-based activation assays indicate that these two zebrafish TLRs are functional, responding to CpG-ODN but not to other TLR ligands. zebTLR9 broadly recognized CpG-ODN with different CpG motifs, but CpG-ODN with GACGTT or AACGTT had better activity to this TLR. In contrast, zebTLR21 responded preferentially to CpG-ODN with GTCGTT motifs. The distinctive ligand recognition profiles of these two TLRs were determined by their ectodomains. Activation of these two TLRs by CpG-ODN occurred inside the cells and was modulated by UNC93B1. The biological functions of these two TLRs were further investigated. The CpG-ODNs that activate both zebTLR9 and zebTLR21 were more potent than others that activate only zebTLR9 in the activation of cytokine productions and were more bactericidal in zebrafish. These results suggest that zebTLR9 and zebTLR21 cooperatively mediate the antimicrobial activities of CpG-ODN. Overall, this study provides a molecular basis for the activities of CpG-ODN in fish.
| S-EPMC3870712 | biostudies-literature
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress