Browse
Submit Data
Databases
API
Help

Dataset Information

20 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Reactivity of Thiol-Rich Zn Sites in Diacylglycerol-Sensing PKC C1 Domain Probed by NMR Spectroscopy.

ABSTRACT: Conserved homology 1 (C1) domains are peripheral zinc finger domains that are responsible for recruiting their host signaling proteins, including Protein Kinase C (PKC) isoenzymes, to diacylglycerol-containing lipid membranes. In this work, we investigated the reactivity of the C1 structural zinc sites, using the cysteine-rich C1B regulatory region of the PKCα isoform as a paradigm. The choice of Cd²⁺ as a probe was prompted by previous findings that xenobiotic metal ions modulate PKC activity. Using solution NMR and UV-vis spectroscopy, we found that Cd²⁺ spontaneously replaced Zn²⁺ in both structural sites of the C1B domain, with the formation of all-Cd and mixed Zn/Cd protein species. The Cd²⁺ substitution for Zn²⁺ preserved the C1B fold and function, as probed by its ability to interact with a potent tumor-promoting agent. Both Cys₃His metal-ion sites of C1B have higher affinity to Cd²⁺ than Zn²⁺, but are thermodynamically and kinetically inequivalent with respect to the metal ion replacement, despite the identical coordination spheres. We find that even in the presence of the oxygen-rich sites presented by the neighboring peripheral membrane-binding C2 domain, the thiol-rich sites can successfully compete for the available Cd²⁺. Our results indicate that Cd²⁺ can target the entire membrane-binding regulatory region of PKCs, and that the competition between the thiol- and oxygen-rich sites will likely determine the activation pattern of PKCs.

SUBMITTER: Cole TR

PROVIDER: S-EPMC8382798 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Excited States of Nucleic Acids Probed by Proton Relaxation Dispersion NMR Spectroscopy.

Project description:In this work an improved stable isotope labeling protocol for nucleic acids is introduced. The novel building blocks eliminate/minimize homonuclear (13) C and (1) H scalar couplings thus allowing proton relaxation dispersion (RD) experiments to report accurately on the chemical exchange of nucleic acids. Using site-specific (2) H and (13) C labeling, spin topologies are introduced into DNA and RNA that make (1) H relaxation dispersion experiments applicable in a straightforward manner. The novel RNA/DNA building blocks were successfully incorporated into two nucleic acids. The A-site RNA was previously shown to undergo a two site exchange process in the micro- to millisecond time regime. Using proton relaxation dispersion experiments the exchange parameters determined earlier could be recapitulated, thus validating the proposed approach. We further investigated the dynamics of the cTAR DNA, a DNA transcript that is involved in the viral replication cycle of HIV-1. Again, an exchange process could be characterized and quantified. This shows the general applicablility of the novel labeling scheme for (1) H RD experiments of nucleic acids.

| S-EPMC5082494 | biostudies-literature

Reorientation dynamics and ion diffusivity of neat dimethylimidazolium dimethylphosphate probed by NMR spectroscopy.

Project description:NMR spectroscopy at two magnetic field strengths was employed to investigate the dynamics of dimethylimidazolium dimethylphosphate ([C1C1IM][(CH3)2PO4]). [C1C1IM][(CH3)2PO4] is a low-melting, halogen-free ionic liquid comprising of only methyl groups. 13C spin-lattice relaxation rates as well as self-diffusion coefficients were measured for [C1C1IM][(CH3)2PO4] as a function of temperature. The rotational correlation times, τ c, for the cation and the anion were obtained from the 13C spin-lattice relaxation rates. Although from a theoretical point of view cations and anions are similar in size, they show different reorientation mobilities and diffusivities. The self-diffusion coefficients and the rotational correlation times were related to the radii of the diffusing spheres. The analysis reveals that the radii of the cation and the anion, respectively, are different from each other but constant at temperatures ranging from 293 to 353 K. The experimental results are rationalised by a discrete and individual cation and anion diffusion. The [(CH3)2PO4]- anion reorients faster compared to the cation but diffuses significantly slower indicating the formation of anionic aggregates. Relaxation data were acquired with standard liquid and magic-angle-spinning NMR probes to estimate residual dipolar interactions, chemical shift anisotropy or differences in magnetic susceptibility within the sample.

| S-EPMC9074696 | biostudies-literature

Protein-Protein Interfaces Probed by Methyl Labeling and Proton-Detected Solid-State NMR Spectroscopy.

Project description:Proton detection and fast magic-angle spinning have advanced biological solid-state NMR, allowing for the backbone assignment of complex protein assemblies with high sensitivity and resolution. However, so far no method has been proposed to detect intermolecular interfaces in these assemblies by proton detection. Herein, we introduce a concept based on methyl labeling that allows for the assignment of these moieties and for the study of protein-protein interfaces at atomic resolution.

| S-EPMC6220863 | biostudies-literature

Concentration gradients in evaporating binary droplets probed by spatially resolved Raman and NMR spectroscopy.

Project description:Understanding the evaporation process of binary sessile droplets is essential for optimizing various technical processes, such as inkjet printing or heat transfer. Liquid mixtures whose evaporation and wetting properties may differ significantly from those of pure liquids are particularly interesting. Concentration gradients may occur in these binary droplets. The challenge is to measure concentration gradients without affecting the evaporation process. Here, spectroscopic methods with spatial resolution can discriminate between the components of a liquid mixture. We show that confocal Raman microscopy and spatially resolved NMR spectroscopy can be used as complementary methods to measure concentration gradients in evaporating 1-butanol/1-hexanol droplets on a hydrophobic surface. Deuterating one of the liquids allows analysis of the local composition through the comparison of the intensities of the C–H and C–D stretching bands in Raman spectra. Thus, a concentration gradient in the evaporating droplet was established. Spatially resolved NMR spectroscopy revealed the composition at different positions of a droplet evaporating in the NMR tube, an environment in which air exchange is less pronounced. While not being perfectly comparable, both methods—confocal Raman and spatially resolved NMR experiments—show the presence of a vertical concentration gradient as 1-butanol/1-hexanol droplets evaporate.

| S-EPMC9169657 | biostudies-literature

Intermolecular alignment in Y145Stop human prion protein amyloid fibrils probed by solid-state NMR spectroscopy.

Project description:The Y145Stop mutant of human prion protein, huPrP23-144, has been linked to PrP cerebral amyloid angiopathy, an inherited amyloid disease, and also serves as a valuable in vitro model for investigating the molecular basis of amyloid strains. Prior studies of huPrP23-144 amyloid by magic-angle-spinning (MAS) solid-state NMR spectroscopy revealed a compact β-rich amyloid core region near the C-terminus and an unstructured N-terminal domain. Here, with the focus on understanding the higher-order architecture of huPrP23-144 fibrils, we probed the intermolecular alignment of β-strands within the amyloid core using MAS NMR techniques and fibrils formed from equimolar mixtures of (15)N-labeled protein and (13)C-huPrP23-144 prepared with [1,3-(13)C(2)] or [2-(13)C]glycerol. Numerous intermolecular correlations involving backbone atoms observed in 2D (15)N-(13)C spectra unequivocally suggest an overall parallel in-register alignment of the β-sheet core. Additional experiments that report on intermolecular (15)N-(13)CO and (15)N-(13)Cα dipolar couplings yielded an estimated strand spacing that is within ∼10% of the distances of 4.7-4.8 Å typical for parallel β-sheets.

| S-EPMC3164902 | biostudies-literature

Tuning the H-Atom Transfer Reactivity of Iron(IV)-Oxo Complexes as Probed by Infrared Photodissociation Spectroscopy.

Project description:Reactivities of non-heme iron(IV)-oxo complexes are mostly controlled by the ligands. Complexes with tetradentate ligands such as [(TPA)FeO]2+ (TPA=tris(2-pyridylmethyl)amine) belong to the most reactive ones. Here, we show a fine-tuning of the reactivity of [(TPA)FeO]2+ by an additional ligand X (X=CH3 CN, CF3 SO3 - , ArI, and ArIO; ArI=2-(t BuSO2 )C6 H4 I) attached in solution and reveal a thus far unknown role of the ArIO oxidant. The HAT reactivity of [(TPA)FeO(X)]+/2+ decreases in the order of X: ArIO > MeCN > ArI ≈ TfO- . Hence, ArIO is not just a mere oxidant of the iron(II) complex, but it can also increase the reactivity of the iron(IV)-oxo complex as a labile ligand. The detected HAT reactivities of the [(TPA)FeO(X)]+/2+ complexes correlate with the Fe=O and FeO-H stretching vibrations of the reactants and the respective products as determined by infrared photodissociation spectroscopy. Hence, the most reactive [(TPA)FeO(ArIO)]2+ adduct in the series has the weakest Fe=O bond and forms the strongest FeO-H bond in the HAT reaction.

| S-EPMC8048595 | biostudies-literature

Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy.

Project description:The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.

| S-EPMC1302107 | biostudies-other

Domain-domain interactions in full-length p53 and a specific DNA complex probed by methyl NMR spectroscopy.

Project description:The tumor suppressor p53 is a homotetramer of 4 × 393 residues. Its core domain and tetramerization domain are linked and flanked by intrinsically disordered sequences, which hinder its full structural characterization. There is an outstanding problem of the state of the tetramerization domain. Structural studies on the isolated tetramerization domain show it is in a folded tetrameric conformation, but there are conflicting models from electron microscopy of the full-length protein, one of which proposes that the domain is not tetramerically folded and the tetrameric protein is stabilized by interactions between the N and C termini. Here, we present methyl-transverse relaxation optimized NMR spectroscopy (methyl-TROSY) investigations on the full-length and separate domains of the protein with its methionine residues enriched with (13)C to probe its quaternary structure. We obtained high-quality spectra of both the full-length tetrameric p53 and its DNA complex, observing the environment at 11 specific methyl sites. The tetramerization domain was as tetramerically folded in the full-length constructs as in the isolated domain. The N and C termini were intrinsically disordered in both the full-length protein and its complex with a 20-residue specific DNA sequence. Additionally, we detected in the interface of the core (DNA-binding) and N-terminal parts of the protein a slow conformational exchange process that was modulated by specific recognition of DNA, indicating allosteric processes.

| S-EPMC3465378 | biostudies-literature

Ligand-induced conformational changes of the multidrug resistance transporter EmrE probed by oriented solid-state NMR spectroscopy.

Project description: Not available

| S-EPMC3876743 | biostudies-literature

Ligand-modulated folding of the full-length adenine riboswitch probed by NMR and single-molecule FRET spectroscopy.

Project description:The full-length translation-regulating add adenine riboswitch (Asw) from Vibrio vulnificus has a more complex conformational space than its isolated aptamer domain. In addition to the predicted apo (apoA) and holo conformation that feature the conserved three-way junctional purine riboswitch aptamer, it adopts a second apo (apoB) conformation with a fundamentally different secondary structure. Here, we characterized the ligand-dependent conformational dynamics of the full-length add Asw by NMR and by single-molecule FRET (smFRET) spectroscopy. Both methods revealed an adenine-induced secondary structure switch from the apoB-form to the apoA-form that involves no tertiary structural interactions between aptamer and expression platform. This strongly suggests that the add Asw triggers translation by capturing the apoA-form secondary structure in the holo state. Intriguingly, NMR indicated a homogenous, docked aptamer kissing loop fold for apoA and holo, while smFRET showed persistent aptamer kissing loop docking dynamics between comparably stable, undocked and docked substates of the apoA and the holo conformation. Unraveling the folding of large junctional riboswitches thus requires the integration of complementary solution structural techniques such as NMR and smFRET.

| S-EPMC5605240 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data