CHD4 variants are associated with childhood idiopathic epilepsy with sinus arrhythmia.
Ontology highlight
ABSTRACT: Aims
CHD4 gene, encoding chromodomain helicase DNA-binding protein 4, is a vital gene for fetal development. In this study, we aimed to explore the association between CHD4 variants and idiopathic epilepsy.Methods
Trios-based whole-exome sequencing was performed in a cohort of 482 patients with childhood idiopathic epilepsy. The Clinical Validity Framework of ClinGen and an evaluating method from five clinical-genetic aspects were used to determine the association between CHD4 variants and epilepsy.Results
Four novel heterozygous missense mutations in CHD4, including two de novo mutations (c.1597A>G/p.K533E and c.4936G>A/p.E1646K) and two inherited mutations with co-segregation (c.856C>G/p.P286A and c.4977C>G/p.D1659E), were identified in four unrelated families with eight individuals affected. Seven affected individuals had sinus arrhythmia. From the molecular sub-regional point of view, the missense mutations located in the central regions from SNF2-like region to DUF1087 domain were associated with multisystem developmental disorders, while idiopathic epilepsy-related mutations were outside this region. Strong evidence from ClinGen Clinical Validity Framework and evidences from four of the five clinical-genetic aspects suggested an association between CHD4 variants and epilepsy.Conclusions
CHD4 was potentially a candidate pathogenic gene of childhood idiopathic epilepsy with arrhythmia. The molecular sub-regional effect of CHD4 mutations helped explaining the mechanisms underlying phenotypic variations.
SUBMITTER: Liu XR
PROVIDER: S-EPMC8446219 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:RYR2 encodes ryanodine receptor 2 protein (RYR-2) that is mainly located on endoplasmic reticulum membrane and regulates intracellular calcium concentration. The RYR-2 protein is ubiquitously distributed and highly expressed in the heart and brain. Previous studies have identified the RYR2 mutations in the etiology of arrhythmogenic right ventricular dysplasia 2 and catecholaminergic polymorphic ventricular tachycardia. However, the relationship between RYR2 gene and epilepsy is not determined. In this study, we screened for novel genetic variants in a group of 292 cases (families) with benign epilepsy of childhood with centrotemporal spikes (BECTS) by trio-based whole-exome sequencing. RYR2 mutations were identified in five cases with BECTS, including one heterozygous frameshift mutation (c.14361dup/p.Arg4790Pro fs∗6), two heterozygous missense mutations (c.2353G > A/p.Asp785Asn and c.8574G > A/p.Met2858Ile), and two pairs of compound heterozygous mutations (c.4652A > G/p.Asn1551Ser and c.11693T > C/p.Ile3898Thr, c.7469T > C/p.Val2490Ala and c.12770G > A/p.Arg4257Gln, respectively). Asp785Asn was a de novo missense mutation. All the missense mutations were suggested to be damaging by at least three web-based prediction tools. These mutations do not present or at low minor allele frequency in gnomAD database and present statistically higher frequency in the cohort of BECTS than in the control populations of gnomAD. Asp785Asn, Asn1551Ser, and Ile3898Thr were predicted to affect hydrogen bonds with surrounding amino acids. Three affected individuals had arrhythmia (sinus arrhythmia and occasional atrial premature). The two probands with compound heterozygous missense mutations presented mild cardiac structural abnormalities. Strong evidence from ClinGen Clinical Validity Framework suggested an association between RYR2 variants and epilepsy. This study suggests that RYR2 gene is potentially a candidate pathogenic gene of BECTS. More attention should be paid to epilepsy patients with RYR2 mutations, which were associated with arrhythmia and sudden unexpected death in previous reports.
| S-EPMC8058200 | biostudies-literature
Project description:BACKGROUND:Deficits of inhibitory control in early childhood are linked to externalizing behaviors and attention problems. While environmental factors and physiological processes are associated with its etiology, few studies have examined how these factors jointly predict inhibitory control. This study examined whether respiratory sinus arrhythmia (RSA) functioned as a mediator or moderator of both cumulative sociodemographic risk and parenting behaviors on inhibitory control during early childhood. METHODS:The sample included 206 children and their biological mothers. At 24, 30, and 36 months of child age dyads participated in a series of laboratory visits in which sociodemographic, parenting, and baseline RSA (RSAB) data were collected. Inhibitory control was assessed at 36 months using a gift-wrap delay task. RESULTS:A series of structural equation models yielded no evidence that RSAB mediated the relations of risk or parenting and inhibitory control. RSAB moderated the effects of risk, such that high-risk children with low RSAB performed more poorly on tasks of inhibitory control, while high-risk children with high RSAB did not. CONCLUSIONS:These results suggest that higher levels of RSAB may mitigate the influence of environmental risk on the development of inhibitory control early childhood.
| S-EPMC7359026 | biostudies-literature
Project description:IntroductionIdiopathic focal epilepsy (IFE) is a group of self-limited epilepsies. The etiology for the majority of the patients with IFE remains elusive. We thus screened disease-causing variants in the patients with IFE.MethodsWhole-exome sequencing was performed in a cohort of 323 patients with IFE. Protein modeling was performed to predict the effects of missense variants. The genotype-phenotype correlation of the newly defined causative gene was analyzed.ResultsFour novel heterozygous variants in PGM3, including two de novo variants, were identified in four unrelated individuals with IFE. The variants included one truncating variant (c.1432C > T/p.Q478X) and three missense variants (c.478C > T/p.P160S, c.1239C > G/p.N413K, and c.1659T > A/p.N553K), which had no allele frequency in the gnomAD database. The missense variants were predicted to be damaging and affect hydrogen bonds with surrounding amino acids. Mutations Q478X, P160S, and N413K were associated with benign childhood epilepsy with centrotemporal electroencephalograph (EEG) spikes. P160S and N413K were located in the inner side of the enzyme active center. Mutation N553K was associated with benign occipital epilepsy with incomplete penetrance, located in the C-terminal of Domain 4. Further analysis demonstrated that previously reported biallelic PGM3 mutations were associated with severe immunodeficiency and/or congenital disorder of glycosylation, commonly accompanied by neurodevelopmental abnormalities, while monoallelic mutations were associated with milder symptoms like IFE.ConclusionThe genetic and molecular evidence from the present study implies that the PGM3 variants identified in IFE patients lead to defects of the PGM3 gene, suggesting that the PGM3 gene is potentially associated with epilepsy. The genotype-phenotype relationship of PGM3 mutations suggested a quantitative correlation between genetic impairment and phenotypic severity, which helps explain the mild symptoms and incomplete penetrance in individuals with IFE.
| S-EPMC7597759 | biostudies-literature
Project description:IntroductionVulnerability factors like respiratory sinus arrhythmia (RSA) may help identify adolescents at risk for nicotine dependence. We examined if resting RSA and the acute effects of smoking on RSA was associated with cigarette smoking five years later among adolescents at high risk for smoking escalation and nicotine dependence.MethodsSixty-nine adolescents participated in a baseline laboratory session- RSA was collected before and after smoking a single cigarette ad libitum. Participants were then followed for five years.ResultsLower pre-smoke resting RSA was related to higher past month smoking rate five years later, even after controlling for baseline smoking rate and other relevant covariates including gender, race/ethnicity, age of initiated use, and frequency of exercise at baseline (p=0.018). Exploratory analyses suggested resting RSA is an independent predictor of increased cigarette rate beyond other baseline predictors.ConclusionsLow resting RSA may be a vulnerability factor, helping to identify adolescents at risk for cigarette escalation.
| S-EPMC4956523 | biostudies-literature
Project description:Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (?19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ?19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ?19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.
| S-EPMC6826448 | biostudies-literature
Project description:The study was conducted to investigate the implications of anthropometry in school-aged children on the degree of respiratory sinus arrhythmia observed in clinical settings. In a cohort study, 626 healthy children (52% male) aged 10.8 ± 0.5 years attending primary school in a single town underwent a 12-lead electrocardiogram coupled with measurements of height, weight and blood pressure. Indices of respiratory sinus arrhythmia (pvRSA, RMSSD, RMSSDc) were derived from semi-automatic measurements of RR intervals. Height, weight, BMI, blood pressure as well as waist and hip circumferences were compared between subjects with rhythmic heart rate and respiratory sinus arrhythmia, and correlations between indices of sinus arrhythmia and anthropometry were investigated. Respiratory sinus arrhythmia was recognized in 43% of the participants. Subjects with sinus arrhythmia had lower heart rate (p < 0.001), weight (p = 0.009), BMI (p = 0.005) and systolic (p = 0.018) and diastolic (p = 0.004) blood pressure. There were important inverse correlations of heart rate and indices of sinus arrhythmia (r = -0.52 for pvRSA and r = -0.58 for RMSSD), but not the anthropometry. Lower prevalence of respiratory sinus arrhythmia among children with overweight and obesity is a result of higher resting heart rate observed in this population.
| S-EPMC8744931 | biostudies-literature
Project description:Background: Respiratory sinus arrhythmia (RSA) is associated with better health in children. Aim: The study was conducted to analyze the trajectory of RSA in 10-year-olds. Methods: A follow-up study on 120 healthy children (62 boys) aged 10.7 ± 0.5 years consisted of a standard 12-lead electrocardiogram, measurements of height, weight and blood pressure. The protocol was repeated after 3 years. Assessment of RSA based on semi-automatic measurements of RR intervals included: the difference between the longest and shortest RR interval duration (pvRSA), the root mean square of differences between successive RR intervals (RMSSD), the standard deviation of the RR interval length (SDNN) and their equivalents corrected for heart rate (RMSSDc and SDNNc). Results: A the first visit 61.7% of children presented with RSA; 51.7% 3 years later. 23.3% of them had RSA only on the first examination; 13.3% only on the second one. The pvRSA, RMSSD, and SDNN measured in 2019 did not differ significantly from their 2016 equivalents (p > 0.05). The decline in RSA defined by RMSSD was noted in 52.5% of children and in 54.2% when defined by SDNN. The corrected values decreased in 68.3 and 64.2% of the participants for RMSSDc and SDNNc, respectively. The students with RSA at both visits had lower heart rate (p < 0.001) and systolic blood pressure (p = 0.010) compared to those with rhythmic electrocardiograms. Conclusions: RSA in children is changeable, though its measurable indices should be adjusted to heart rate.
| S-EPMC8172810 | biostudies-literature
Project description:BackgroundNeurocysticercosis (NCC), a neglected tropical disease, inflicts substantial health and economic costs on people living in endemic areas such as India. Nevertheless, accurate diagnosis using brain imaging remains poorly accessible and too costly in endemic countries. The goal of this study was to test if blood monocyte gene expression could distinguish patients with NCC-associated epilepsy, from NCC-negative imaging lesion-free patients presenting with idiopathic epilepsy or idiopathic headaches.Methods/principal findingsPatients aged 18 to 51 were recruited from the Department of Neurological Sciences, Christian Medical College and Hospital, Vellore, India, between January 2013 and October 2014. mRNA from CD14+ blood monocytes was isolated from 76 patients with NCC, 10 Recovered NCC (RNCC), 29 idiopathic epilepsy and 17 idiopathic headaches patients. A preliminary microarray analysis was performed on six NCC, six idiopathic epilepsy and four idiopathic headaches patients to identify genes differentially expressed in NCC-associated epilepsy compared with other groups. This analysis identified 1411 upregulated and 733 downregulated genes in patients with NCC compared to Idiopathic Epilepsy. Fifteen genes up-regulated in NCC patients compared with other groups were selected based on possible relevance to NCC, and analyzed by qPCR in all patients' samples. Differential gene expression among patients was assessed using linear regression models. qPCR analysis of 15 selected genes showed generally higher gene expression among NCC patients, followed by RNCC, idiopathic headaches and Idiopathic Epilepsy. Gene expression was also generally higher among NCC patients with single cyst granulomas, followed by mixed lesions and single calcifications.Conclusions/significanceExpression of certain genes in blood monocytes can distinguish patients with NCC-related epilepsy from patients with active Idiopathic Epilepsy and idiopathic headaches. These findings are significant because they may lead to the development of new tools to screen for and monitor NCC patients without brain imaging.
| S-EPMC5489221 | biostudies-literature
Project description:BackgroundHCFC1 encodes transcriptional co-regulator HCF-1, which undergoes an unusual proteolytic maturation at a centrally located proteolysis domain. HCFC1 variants were associated with X-linked cobalamin metabolism disorders and mental retardation-3. This study aimed to explore the role of HCFC1 variants in common epilepsy and the mechanism underlying phenotype heterogeneity.MethodsWhole-exome sequencing was performed in a cohort of 313 patients with idiopathic partial (focal) epilepsy. Functional studies determined the effects of the variants on the proteolytic maturation of HCF-1, cell proliferation and MMACHC expression. The role of HCFC1 variants in partial epilepsy was validated in another cohort from multiple centers.ResultsWe identified seven hemizygous HCFC1 variants in 11 cases and confirmed the finding in the validation cohort with additional 13 cases and six more hemizygous variants. All patients showed partial epilepsies with favorable outcome. None of them had cobalamin disorders. Functional studies demonstrated that the variants in the proteolysis domain impaired the maturation by disrupting the cleavage process with loss of inhibition of cell growth but did not affect MMACHC expression that was associated with cobalamin disorder. The degree of functional impairment was correlated with the severity of phenotype. Further analysis demonstrated that variants within the proteolysis domain were associated with common and mild partial epilepsy, whereas those in the kelch domain were associated with cobalamin disorder featured by severe and even fatal epileptic encephalopathy, and those in the basic and acidic domains were associated with mainly intellectual disability.ConclusionHCFC1 is potentially a candidate gene for common partial epilepsy with distinct underlying mechanism of proteolysis dysfunction. The HCF-1 domains played distinct functional roles and were associated with different clinical phenotypes, suggesting a sub-molecular effect. The distinct difference between cobalamin disorders and idiopathic partial epilepsy in phenotype and pathogenic mechanism, implied a clinical significance in early diagnosis and management.
| S-EPMC10235798 | biostudies-literature
Project description:Mutations in the coding sequence of SCN5A, which encodes the cardiac Na(+) channel α subunit, have been associated with inherited susceptibility to various arrhythmias. Variable expression of SCN5A is a possible mechanism responsible for this pleiotropic effect; however, it is unknown whether variants in the promoter and regulatory regions of SCN5A also modulate the risk of arrhythmias. We resequenced the core promoter region of SCN5A and the regulatory regions of SCN5A transcription in 1298 patients with arrhythmia phenotypes (atrial fibrillation, n=444; sinus node dysfunction, n=49; conduction disease, n=133; Brugada syndrome, n=583; and idiopathic ventricular fibrillation, n=89). We identified 26 novel rare variants in the SCN5A promoter in 29 patients affected by various arrhythmias (atrial fibrillation, n=6; sinus node dysfunction, n=1; conduction disease, n=3; Brugada syndrome, n=14; idiopathic ventricular fibrillation, n=5). The frequency of rare variants was higher in patients with arrhythmias than in controls. In the alignment with chromatin immunoprecipitation sequencing data, the majority of variants were located at regions bound by transcription factors. Using a luciferase reporter assay, 6 variants (Brugada syndrome, n=3; idiopathic ventricular fibrillation, n=2; conduction disease, n=1) were functionally characterized, and each displayed decreased promoter activity compared with the wild-type sequences. We also identified rare variants in the regulatory region that were associated with atrial fibrillation, and the variant decreased promoter activity. Variants in the core promoter region and the transcription regulatory region of SCN5A were identified in multiple arrhythmia phenotypes, consistent with the idea that altered SCN5A transcription levels modulate susceptibility to arrhythmias.
| S-EPMC5079027 | biostudies-literature