Unknown

Dataset Information

0

TRIM39-RPP21 Variants (?19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.


ABSTRACT: Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (?19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ?19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ?19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

SUBMITTER: Rivas VN 

PROVIDER: S-EPMC6826448 | biostudies-literature | 2019 Oct

REPOSITORIES: biostudies-literature

altmetric image

Publications

<i>TRIM39-RPP21</i> Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Rivas Victor N VN   Aleman Monica M   Peterson Janel A JA   Dahlgren Anna R AR   Hales Erin N EN   Finno Carrie J CJ  

Genes 20191016 10


Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the <i>Tripartite Motif-Containing 39-Ribonucle  ...[more]

Similar Datasets

| S-EPMC9031527 | biostudies-literature
2019-01-23 | GSE104388 | GEO
| S-EPMC4848803 | biostudies-other
| S-EPMC8446219 | biostudies-literature
| S-EPMC3089768 | biostudies-literature
| S-EPMC8393258 | biostudies-literature
2016-06-16 | E-GEOD-83404 | biostudies-arrayexpress
| S-EPMC5759045 | biostudies-literature
2016-06-16 | GSE83404 | GEO
| S-EPMC4804485 | biostudies-literature