Dataset Information

TRIM39-RPP21 Variants (?19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

ABSTRACT: Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (?19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ?19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ?19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

SUBMITTER: Rivas VN

PROVIDER: S-EPMC6826448 | biostudies-literature | 2019 Oct

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

<i>TRIM39-RPP21</i> Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Rivas Victor N VN Aleman Monica M Peterson Janel A JA Dahlgren Anna R AR Hales Erin N EN Finno Carrie J CJ

Genes 20191016 10

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the <i>Tripartite Motif-Containing 39-Ribonucle ...[more]

PMID: 31623255

Similar Datasets

Project description:Purpose: Next-generation sequencing (NGS) was used to select genes potentially associated with exercise adaptation in Arabian horses. Methods: Whole transcriptome profiling of blood was performed for untrained horses and horses from which samples were collected during at 3 different periods of training procedure (T1-during intense training period - March, T2- before starts - May and T3 -after flat racing season - October). The muscle transcriptome sequencing was performed for 37 blood samples using Illumina HiScan SQ in 75 single-end cycles. The quantifying transcript abundances was made using the RSEM supported by STAR aligner. The raw reads were aligned to the Equus caballus reference genome. Differentially expressed genes in blood tissue were detected by DESeq2. The RNA-seq results were validated using by qPCR. Results: The increase of the number of DEGs between subsequent training periods has been observed and the highest amount of DEGs was detected between untrained horses (T0) and horses at the end of the racing season (T3) â 440. The comparison of transcriptome of T2 vs T3 and T0 vs T3 showed a significant advantage of up-regulated genes during long-term exercise (up-regulation of 266 and 389 DEGs in T3 period compared T2 and T0; respectively). Our results showed that the largest number of identified genes encoded transcription factors, nucleic acid binding proteins and G-protein modulators, which mainly were transcriptional activated at the last training phase (T3) . Moreover, in the T3 period the identified DEGs represented genes coded for cytoskeletal proteins including actin cytoskeletal proteins and kinases. The most abundant exercise-upregulated genes were involved in pathways important in regulating the cell cycle (PI3K-Akt signaling pathway), cell communication (cAMP-dependent pathway), proliferation, differentiation and apoptosis as well as immunity processes (Jak-STAT signaling pathway). We also observed exercise induced expression of genes related in regulation of actin cytoskeleton, gluconeogenesis (FoxO signaling pathway; Insulin signaling pathway), glycerophospholipid metabolism and calcium signaling. Conclusions: TOur results allow to identify changes in genes expression profile following training schedule in Arabian horses. Based on comparison analysis of blood transcriptomes, several exercise-regulated pathways and genes most affected by exercise were detected. We pinpointed overrepresented molecular pathways and genes essential for exercise adaptive response via maintaining of body homeostasis. The observed transcriptional activation of such gene as LPGAT1, AGPAT5, PIK3CG, GPD2, FOXN2, FOXO3, ACVR1B and ACVR2A can be a base for further research in order to identify genes potentially associated with race performance in Arabian horses. Such markers will be essential to choice the training type, and could result in differences in racing performance specific to various breeds. The blood transcriptome sequencing was performed for 37 samples collected form Arabian horses using Illumina HiScan SQ in75 single-end cycles and in 3-4 technical repetitions.repetitions.

Project description:Purpose: Next-generation sequencing (NGS) was used to select genes potentially associated with exercise adaptation in Arabian horses. Methods: Whole transcriptome profiling of blood was performed for untrained horses and horses from which samples were collected during at 3 different periods of training procedure (T1-during intense training period - March, T2- before starts - May and T3 -after flat racing season - October). The muscle transcriptome sequencing was performed for 37 blood samples using Illumina HiScan SQ in 75 single-end cycles. The quantifying transcript abundances was made using the RSEM supported by STAR aligner. The raw reads were aligned to the Equus caballus reference genome. Differentially expressed genes in blood tissue were detected by DESeq2. The RNA-seq results were validated using by qPCR. Results: The increase of the number of DEGs between subsequent training periods has been observed and the highest amount of DEGs was detected between untrained horses (T0) and horses at the end of the racing season (T3) – 440. The comparison of transcriptome of T2 vs T3 and T0 vs T3 showed a significant advantage of up-regulated genes during long-term exercise (up-regulation of 266 and 389 DEGs in T3 period compared T2 and T0; respectively). Our results showed that the largest number of identified genes encoded transcription factors, nucleic acid binding proteins and G-protein modulators, which mainly were transcriptional activated at the last training phase (T3) . Moreover, in the T3 period the identified DEGs represented genes coded for cytoskeletal proteins including actin cytoskeletal proteins and kinases. The most abundant exercise-upregulated genes were involved in pathways important in regulating the cell cycle (PI3K-Akt signaling pathway), cell communication (cAMP-dependent pathway), proliferation, differentiation and apoptosis as well as immunity processes (Jak-STAT signaling pathway). We also observed exercise induced expression of genes related in regulation of actin cytoskeleton, gluconeogenesis (FoxO signaling pathway; Insulin signaling pathway), glycerophospholipid metabolism and calcium signaling. Conclusions: TOur results allow to identify changes in genes expression profile following training schedule in Arabian horses. Based on comparison analysis of blood transcriptomes, several exercise-regulated pathways and genes most affected by exercise were detected. We pinpointed overrepresented molecular pathways and genes essential for exercise adaptive response via maintaining of body homeostasis. The observed transcriptional activation of such gene as LPGAT1, AGPAT5, PIK3CG, GPD2, FOXN2, FOXO3, ACVR1B and ACVR2A can be a base for further research in order to identify genes potentially associated with race performance in Arabian horses. Such markers will be essential to choice the training type, and could result in differences in racing performance specific to various breeds.

Dataset Information

TRIM39-RPP21 Variants (?19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Publications

<i>TRIM39-RPP21</i> Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure