TRIM39-RPP21 Variants (?19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Ontology highlight
ABSTRACT:
SUBMITTER: Rivas VN
PROVIDER: S-EPMC6826448 | biostudies-literature | 2019 Oct
REPOSITORIES: biostudies-literature
Publications
<i>TRIM39-RPP21</i> Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Rivas Victor N VN Aleman Monica M Peterson Janel A JA Dahlgren Anna R AR Hales Erin N EN Finno Carrie J CJ
Genes 20191016 10
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the <i>Tripartite Motif-Containing 39-Ribonucle ...[more]
Similar Datasets
Project description:Juvenile idiopathic epilepsy (JIE) is a self-limiting neurological disorder with a suspected genetic predisposition affecting young Arabian foals of the Egyptian lineage. The condition is characterized by tonic-clonic seizures with intermittent post-ictal blindness, in which most incidents are sporadic and unrecognized. This study aimed to identify genetic components shared across a local cohort of Arabian foals diagnosed with JIE via a combined whole genome and targeted resequencing approach: Initial whole genome comparisons between a small cohort of nine diagnosed foals (cases) and 27 controls from other horse breeds identified variants uniquely shared amongst the case cohort. Further validation via targeted resequencing of these variants, that pertain to non-intergenic regions, on additional eleven case individuals revealed a single 19bp deletion coupled with a triple-C insertion (Δ19InsCCC) within the TRIM39-RPP21 gene readthrough that was uniquely shared across all case individuals, and absent from three additional Arabian controls. Furthermore, we have confirmed recent findings refuting potential linkage between JIE and other inherited diseases in the Arabian lineage, and refuted the potential linkage between JIE and genes predisposing a similar disorder in human newborns. This is the first study to report a genetic variant to be shared in a sub-population cohort of Arabian foals diagnosed with JIE. Further evaluation of the sensitivity and specificity of the Δ19InsCCC allele within additional cohorts of the Arabian horse is warranted in order to validate its credibility as a marker for JIE, and to ascertain whether it has been introduced into other horse breeds by Arabian ancestry.
| S-EPMC9031527 | biostudies-literature
Project description:Report transcritpome analysis of Arabian horses before and after exercise
2019-01-23 | GSE104388 | GEO
Project description:Juvenile idiopathic arthritis (JIA) is the most common rheumatic disease of childhood, with JIA-associated uveitis its most common extra-articular manifestation. JIA-associated uveitis is a potentially sight-threatening condition and thus carries a considerable risk of morbidity. The aetiology of the condition is autoimmune in nature with the predominant involvement of CD4(+) T cells. However, the underlying pathogenic mechanisms remain unclear, particularly regarding interplay between genetic and environmental factors. JIA-associated uveitis comes in several forms, but the most common presentation is of the chronic anterior uveitis type. This condition is usually asymptomatic and thus screening for JIA-associated uveitis in at-risk patients is paramount. Early detection and treatment aims to stop inflammation and prevent the development of complications leading to visual loss, which can occur due to both active disease and burden of disease treatment. Visually disabling complications of JIA-associated uveitis include cataracts, glaucoma, band keratopathy and macular oedema. There is a growing body of evidence for the early introduction of systemic immunosuppressive therapies in order to reduce topical and systemic glucocorticoid use. This includes more traditional treatments, such as methotrexate, as well as newer biological therapies. This review highlights the epidemiology of JIA-associated uveitis, the underlying pathogenesis and how affected patients may present. The current guidelines and criteria for screening, diagnosis and monitoring are discussed along with approaches to management.
| S-EPMC4848803 | biostudies-other
Project description:AimsCHD4 gene, encoding chromodomain helicase DNA-binding protein 4, is a vital gene for fetal development. In this study, we aimed to explore the association between CHD4 variants and idiopathic epilepsy.MethodsTrios-based whole-exome sequencing was performed in a cohort of 482 patients with childhood idiopathic epilepsy. The Clinical Validity Framework of ClinGen and an evaluating method from five clinical-genetic aspects were used to determine the association between CHD4 variants and epilepsy.ResultsFour novel heterozygous missense mutations in CHD4, including two de novo mutations (c.1597A>G/p.K533E and c.4936G>A/p.E1646K) and two inherited mutations with co-segregation (c.856C>G/p.P286A and c.4977C>G/p.D1659E), were identified in four unrelated families with eight individuals affected. Seven affected individuals had sinus arrhythmia. From the molecular sub-regional point of view, the missense mutations located in the central regions from SNF2-like region to DUF1087 domain were associated with multisystem developmental disorders, while idiopathic epilepsy-related mutations were outside this region. Strong evidence from ClinGen Clinical Validity Framework and evidences from four of the five clinical-genetic aspects suggested an association between CHD4 variants and epilepsy.ConclusionsCHD4 was potentially a candidate pathogenic gene of childhood idiopathic epilepsy with arrhythmia. The molecular sub-regional effect of CHD4 mutations helped explaining the mechanisms underlying phenotypic variations.
| S-EPMC8446219 | biostudies-literature
Project description:To describe recent evidence from the literature pertaining to juvenile idiopathic arthritis (JIA)-associated uveitis.Uveitis is most common in extended oligoarticular JIA. A significant number of patients already have ocular complications at time of diagnosis of uveitis. Risk factors for complications include either abnormally high or low intraocular pressure, posterior synechiae, male sex, temporal proximity to diagnosis of arthritis and topical corticosteroid use. Use of immunosuppressive agents significantly reduces ocular complications. Aggressive perioperative control of intraocular inflammation is necessary for successful cataract surgery with lens implantation. Controlled clinical trials are under way to assess the efficacy of biologic agents in JIA-associated uveitis. Long-term safety, however, is still unknown.JIA-associated uveitis carries significant ocular morbidity that lasts well into adulthood. Treatment with immunosuppressive agents can reduce the risk of ocular complications. Biologic agents hold promise in the treatment of JIA-associated uveitis, but require long-term data to assess their safety.
| S-EPMC3089768 | biostudies-literature
Project description:Juvenile idiopathic arthritis (JIA) is the most common childhood rheumatic disease. The development of associated uveitis represents a significant risk for serious complications, including permanent loss of vision. Initiation of early treatment is important for controlling JIA-uveitis, but the disease can appear asymptomatically, making frequent screening procedures necessary for patients at risk. As our understanding of pathogenic drivers is currently incomplete, it is difficult to assess which JIA patients are at risk of developing uveitis. Identification of specific risk factors for JIA-associated uveitis is an important field of research, and in this review, we highlight the genomic, transcriptomic, and proteomic factors identified as potential uveitis risk factors in JIA, and discuss therapeutic strategies.
| S-EPMC8393258 | biostudies-literature
Project description:Purpose: Next-generation sequencing (NGS) was used to select genes potentially associated with exercise adaptation in Arabian horses. Methods: Whole transcriptome profiling of blood was performed for untrained horses and horses from which samples were collected during at 3 different periods of training procedure (T1-during intense training period - March, T2- before starts - May and T3 -after flat racing season - October). The muscle transcriptome sequencing was performed for 37 blood samples using Illumina HiScan SQ in 75 single-end cycles. The quantifying transcript abundances was made using the RSEM supported by STAR aligner. The raw reads were aligned to the Equus caballus reference genome. Differentially expressed genes in blood tissue were detected by DESeq2. The RNA-seq results were validated using by qPCR. Results: The increase of the number of DEGs between subsequent training periods has been observed and the highest amount of DEGs was detected between untrained horses (T0) and horses at the end of the racing season (T3) â 440. The comparison of transcriptome of T2 vs T3 and T0 vs T3 showed a significant advantage of up-regulated genes during long-term exercise (up-regulation of 266 and 389 DEGs in T3 period compared T2 and T0; respectively). Our results showed that the largest number of identified genes encoded transcription factors, nucleic acid binding proteins and G-protein modulators, which mainly were transcriptional activated at the last training phase (T3) . Moreover, in the T3 period the identified DEGs represented genes coded for cytoskeletal proteins including actin cytoskeletal proteins and kinases. The most abundant exercise-upregulated genes were involved in pathways important in regulating the cell cycle (PI3K-Akt signaling pathway), cell communication (cAMP-dependent pathway), proliferation, differentiation and apoptosis as well as immunity processes (Jak-STAT signaling pathway). We also observed exercise induced expression of genes related in regulation of actin cytoskeleton, gluconeogenesis (FoxO signaling pathway; Insulin signaling pathway), glycerophospholipid metabolism and calcium signaling. Conclusions: TOur results allow to identify changes in genes expression profile following training schedule in Arabian horses. Based on comparison analysis of blood transcriptomes, several exercise-regulated pathways and genes most affected by exercise were detected. We pinpointed overrepresented molecular pathways and genes essential for exercise adaptive response via maintaining of body homeostasis. The observed transcriptional activation of such gene as LPGAT1, AGPAT5, PIK3CG, GPD2, FOXN2, FOXO3, ACVR1B and ACVR2A can be a base for further research in order to identify genes potentially associated with race performance in Arabian horses. Such markers will be essential to choice the training type, and could result in differences in racing performance specific to various breeds. The blood transcriptome sequencing was performed for 37 samples collected form Arabian horses using Illumina HiScan SQ in75 single-end cycles and in 3-4 technical repetitions.repetitions.
2016-06-16 | E-GEOD-83404 | biostudies-arrayexpress
Project description:PurposeVariants in the gene encoding Programmed Cell Death-1 (PDCD1) have been associated with susceptibility to Systemic Lupus Erythematosus and other autoimmune diseases. Given that clinically distinct autoimmune phenotypes share common genetic susceptibility factors, variants in PDCD-1 were tested for a possible association with Juvenile Idiopathic Arthritis (JIA).MethodsFour Single Nucleotide Polymorphisms (SNPS) in the PDCD1 gene were genotyped and analyzed: rs7421861, rs11568821, rs10204525, and rs7568402 in 834 cases and 855 controls of Northern European ancestry. Each variant was examined for possible associations with JIA and then analyzed for association with JIA categories.ResultsPDCD1 variants showed no association with JIA in the cohort overall (rs7421861 p=0.63, rs11568821 p=0.13, rs10204525 p=0.31, and rs7568402 p=0.45). Stratification by JIA categories indicated a significant association between systemic JIA and PDCD1 rs7568402 (OR=0.53, p=0.0027), which remained significant after 10,000 permutations, but was not replicated in an independent multi-ethnic systemic JIA cohort. A nominal association between enthesitis-related arthritis and rs115668821 was also observed (OR=0.22, p=0.012).ConclusionUnlike other multiple autoimmune disease associated genetic variants, there was no association between PDCD1 variants and JIA or JIA categories.
| S-EPMC5759045 | biostudies-literature
Project description:Purpose: Next-generation sequencing (NGS) was used to select genes potentially associated with exercise adaptation in Arabian horses. Methods: Whole transcriptome profiling of blood was performed for untrained horses and horses from which samples were collected during at 3 different periods of training procedure (T1-during intense training period - March, T2- before starts - May and T3 -after flat racing season - October). The muscle transcriptome sequencing was performed for 37 blood samples using Illumina HiScan SQ in 75 single-end cycles. The quantifying transcript abundances was made using the RSEM supported by STAR aligner. The raw reads were aligned to the Equus caballus reference genome. Differentially expressed genes in blood tissue were detected by DESeq2. The RNA-seq results were validated using by qPCR. Results: The increase of the number of DEGs between subsequent training periods has been observed and the highest amount of DEGs was detected between untrained horses (T0) and horses at the end of the racing season (T3) – 440. The comparison of transcriptome of T2 vs T3 and T0 vs T3 showed a significant advantage of up-regulated genes during long-term exercise (up-regulation of 266 and 389 DEGs in T3 period compared T2 and T0; respectively). Our results showed that the largest number of identified genes encoded transcription factors, nucleic acid binding proteins and G-protein modulators, which mainly were transcriptional activated at the last training phase (T3) . Moreover, in the T3 period the identified DEGs represented genes coded for cytoskeletal proteins including actin cytoskeletal proteins and kinases. The most abundant exercise-upregulated genes were involved in pathways important in regulating the cell cycle (PI3K-Akt signaling pathway), cell communication (cAMP-dependent pathway), proliferation, differentiation and apoptosis as well as immunity processes (Jak-STAT signaling pathway). We also observed exercise induced expression of genes related in regulation of actin cytoskeleton, gluconeogenesis (FoxO signaling pathway; Insulin signaling pathway), glycerophospholipid metabolism and calcium signaling. Conclusions: TOur results allow to identify changes in genes expression profile following training schedule in Arabian horses. Based on comparison analysis of blood transcriptomes, several exercise-regulated pathways and genes most affected by exercise were detected. We pinpointed overrepresented molecular pathways and genes essential for exercise adaptive response via maintaining of body homeostasis. The observed transcriptional activation of such gene as LPGAT1, AGPAT5, PIK3CG, GPD2, FOXN2, FOXO3, ACVR1B and ACVR2A can be a base for further research in order to identify genes potentially associated with race performance in Arabian horses. Such markers will be essential to choice the training type, and could result in differences in racing performance specific to various breeds.
2016-06-16 | GSE83404 | GEO
Project description:BackgroundJuvenile idiopathic arthritis (JIA) is the most common chronic rheumatic disease among children, the etiology of which involves a strong genetic component, but much of the underlying genetic determinants still remain unknown. Our aim was to identify novel genetic variants that predispose to JIA.MethodsWe performed a genome-wide association study (GWAS) and replication in a total of 1166 JIA cases and 9500 unrelated controls of European ancestry. Correlation of SNP genotype and gene expression was investigated. Then we conducted targeted resequencing of a candidate locus, among a subset of 480 cases and 480 controls. SUM test was performed to evaluate the association of the identified rare functional variants.ResultsThe CXCR4 locus on 2q22.1 was found to be significantly associated with JIA, peaking at SNP rs953387. However, this result is subjected to subpopulation stratification within the subjects of European ancestry. After adjusting for principal components, nominal significant association remained (p < 10(-4)). Because of its interesting known function in immune regulation, we carried out further analyses to assess its relationship with JIA. Expression of CXCR4 was correlated with CXCR4 rs953387 genotypes in lymphoblastoid cell lines (p = 0.014) and T-cells (p = 0.0054). In addition, rare non-synonymous and stop-gain sequence variants in CXCR4, putatively damaging for CXCR4 function, were significantly enriched in JIA cases (p = 0.015).ConclusionOur results suggest the association of CXCR4 variants with JIA, implicating that this gene may be involved in the pathogenesis of autoimmune disease. However, because this locus is subjected to population stratification within the subjects of European ancestry, additional replication is still necessary for this locus to be considered a true risk locus for JIA. This cell-surface chemokine receptor has already been targeted in other diseases and may serve as a tractable therapeutic target for a specific subset of pediatric arthritis patients with additional replication and functional validation of the locus.
| S-EPMC4804485 | biostudies-literature