Toll-Like Receptors (TLRs): Structure, Functions, Signaling, and Role of Their Polymorphisms in Colorectal Cancer Susceptibility.
Ontology highlight
ABSTRACT:
SUBMITTER: Sameer AS
PROVIDER: S-EPMC8452412 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:BackgroundToll-like receptors (TLRs) are important components of the innate and adaptive immune systems, and abnormal TLR expression has been linked to a variety of cancers. However, there was a lack of clarity on the association of TLR stimulation with the carcinogenesis of cancer. The study's goal was to analyse the clinical importance of TLRs expression at the mRNA level in pan-cancer datasets, as well as the link between TLR expression and carcinogenesis, progression, and clinical prognosis.MethodsThe expression profile of TLRs derived from UCSC pan-cancer data was analysed in multiple dimensions, including clinical analysis, immunological subtype analysis, tumour microenvironment (TME) analysis, tumour stem cell correlation analysis, and drug sensitivity analysis. Additionally, we analyse protein-protein interactions, functional enrichment, and chromatin accessibility, as well as TLR expression in single-cell sequencing data.ResultsOur multi-omics analysis results imply that TLRs may operate as a biological marker for carcinogenesis and progression, a potential target for anti-tumour therapy, and a prognostic biomarker, laying the theoretical groundwork for future translational medicine research.ConclusionTLRs are involved in the formation of malignancies and can be explored in further detail as potential prognostic indicators. Key MessagesToll-like receptors (TLRs) are key factors in the process of the innate and adaptive immune response, and their aberrant expression of TLRs have been widely reported in various cancer. However, the association between TLRs stimulation and tumorigenesis of cancer has not been well clarified.In this study, in the pan-cancer data, integrated TLR family gene expression analysis, clinical correlation analysis, immune subtype correlation analysis, tumour microenvironment correlation analysis, tumour stem cell correlation analysis, and drug sensitivity correlation analysis were performed.TLRs play an important role in the development of tumours and can be studied in depth as potential prognostic markers.
| S-EPMC9272932 | biostudies-literature
Project description:Pancreatic cancer (PC) is one of the most lethal forms of cancer, characterized by its aggressiveness and metastatic potential. Despite significant improvements in PC treatment and management, the complexity of the molecular pathways underlying its development has severely limited the available therapeutic opportunities. Toll-like receptors (TLRs) play a pivotal role in inflammation and immune response, as they are involved in pathogen-associated molecular patterns (PAMPs) and danger-associated molecular patterns (DAMPs). Activation of TLRs initiates a signaling cascade, which in turn, leads to the transcription of several genes involved in inflammation and anti-microbial defense. TLRs are also deregulated in several cancers and can be used as prognostic markers and potential targets for cancer-targeted therapy. In this review we discuss the current knowledge about the role of TLRs in PC progression, focusing on the available TLRs-targeting compounds and their possible use in PC therapy.
| S-EPMC8657588 | biostudies-literature
Project description:Members of the family Suidae have diverged over extended evolutionary periods in diverse environments, suggesting that adaptation in response to endemic infectious agents may have occurred. Toll-like receptors (TLRs) comprise a multigene family that acts as the first line of defense against infectious microbes at the host-environment interface. We hypothesized that across the Suidae, positive selection mediated by infectious agents has contributed to the evolution of TLR diversity. Thus, we analyzed Sus scrofa, Sus barbatus, Sus verrucosus, Sus celebensis, Sus scebifrons, Babyrousa babyrussa, Potamochoerus larvatus, Potamochoerus porcus and Phacochoerus africanus genomes. Specifically, analyses were performed to identify evidence of positive selection using Maximum likelihood (ML) methods within a phylogenetic framework for bacterial and viral sensing Suidae TLR extracellular domains. Our analyses did not reveal evidence of positive selection for TLR3 and TLR7, suggesting strong functional conservation among these two genes for members of the Suidae. Positive selection was inferred for Suidae TLR1, TLR2, TLR6 and TLR8 evolution. ML methods identified amino acid sites of the bacterial sensing TLR1, TLR2, TLR6 and the viral sensing TLR8 to be under persistent positive selection. Some of these sites are in close proximity to functionally relevant sites, further strengthening the case for pathogen mediated selection for these sites. The branch leading to the genus Sus demonstrated evidence of episodic positive selection for TLR1, indicating selection mediated by infectious agents encountered within the specific geographic origin of the Sus. These results indicate that species of the Suidae have positively selected residues within functional domains of TLRs reflective of prior infections. Thus, TLR genes represent candidates for experimental validation to determine their functional role in antibacterial and antiviral activity within members of the Suidae.
| S-EPMC4404360 | biostudies-literature
Project description:Toll like receptors (TLRs) use Toll-IL-1 receptor (TIR) domain-containing adapters, such as myeloid differentiation primary response gene 88 (MyD88) and TIR domain-containing adapter inducing IFN-? (TRIF), to induce activation of transcription factors, including NF-?B, MAP kinases, and IFN regulatory factors. TLR signaling also leads to activation of PI3K, but the molecular mechanism is not understood. Here we have discovered a unique role for B-cell adapter for PI3K (BCAP) in the TLR-signaling pathway. We find that BCAP has a functional N-terminal TIR homology domain and links TLR signaling to activation of PI3K. In addition, BCAP negatively regulates proinflammatory cytokine secretion upon TLR stimulation. In vivo, the absence of BCAP leads to exaggerated recruitment of inflammatory myeloid cells following infections and enhanced susceptibility to dextran sulfate sodium-induced colitis. Our results demonstrate that BCAP is a unique TIR domain-containing TLR signaling adapter crucial for linking TLRs to PI3K activation and regulating the inflammatory response.
| S-EPMC3252926 | biostudies-literature
Project description:Interferon regulatory factors (IRFs) are crucial for transcription during innate immune responses. We have previously shown that the tyrosine kinase c-Src enhances IRF-3-dependent transcription in response to viral double-stranded RNA. In this study, we show that c-Src has distinct roles in Toll-like receptor (TLR)-mediated activation of IRF-5 and IRF-3. Surprisingly, c-Src inhibition markedly enhanced IRF-5 activation after treatment with unmethylated CpG, while suppressing IRF-3 activation. Also, CpG-elicited interleukin-6 mRNA production was increased, whereas IP10 mRNA synthesis was reduced in cells deficient in c-Src. Interestingly, c-Src regulated TLR-stimulated induction of activating transcription factor 3 (ATF3), a transcriptional repressor. Depletion of ATF3 by small interfering RNA markedly enhanced interleukin-6 production after CpG treatment, whereas IP10 production was reduced. These results demonstrate functional specificity for c-Src in TLR-stimulated responses and suggest that c-Src modulation and ATF3 activity may contribute to differential regulation of IRF-3- versus IRF-5-mediated gene expression.
| S-EPMC2878043 | biostudies-literature
Project description:Allergic rhinitis represents a global health issue affecting 10% to 25% of the population worldwide. Over the years, studies have found that allergic diseases, including allergic rhinitis, are associated with immunological responses to antigens driven by a Th2-mediated immune response. Because Toll-like receptors (TLRs) are involved in both innate and adaptive immune responses to a broad variety of antigens, the association between polymorphisms of TLRs and allergic diseases has been the focus in many animal and human studies. Although the etiology of allergic rhinitis is still unknown, extensive research over the years has confirmed that the underlying causes of allergic diseases are due to many genetic and environmental factors, along with the interactions among them, which include gene-environment, gene-gene, and environment-environment interactions. Currently, there is great inconsistency among studies mainly due to differences in genetic background and unique gene-environment interactions. This paper reviews studies focusing on the association between TLR polymorphisms and allergic diseases, including allergic rhinitis, which would help researchers better understand the role of TLR polymorphisms in the development of allergic rhinitis, and ultimately lead to more efficient therapeutic interventions being developed.
| S-EPMC3681168 | biostudies-literature
Project description:Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-? Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-?, IFN-?, IFN?-1, and TNF-? secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.
| S-EPMC3924423 | biostudies-literature
Project description:While platelet function has traditionally been described in the context of maintaining vascular integrity, recent evidence suggests that platelets can modulate inflammation in a much more sophisticated and nuanced manner than previously thought. Some aspects of this expanded repertoire of platelet function are mediated via expression of Toll-like receptors (TLRs). TLRs are a family of pattern recognition receptors that recognize pathogen-associated and damage-associated molecular patterns. Activation of these receptors is crucial for orchestrating and sustaining the inflammatory response to both types of danger signals. The TLR family consists of 10 known receptors, and there is at least some evidence that each of these are expressed on or within human platelets. This review presents the literature on TLR-mediated platelet activation for each of these receptors, and the existing understanding of platelet-TLR immune modulation. This review also highlights unresolved methodological issues that potentially contribute to some of the discrepancies within the literature, and we also suggest several recommendations to overcome these issues. Current understanding of TLR-mediated platelet responses in influenza, sepsis, transfusion-related injury and cardiovascular disease are discussed, and key outstanding research questions are highlighted. In summary, we provide a resource-a "researcher's toolkit"-for undertaking further research in the field of platelet-TLR biology.
| S-EPMC7504402 | biostudies-literature
Project description:Sepsis is a condition characterized by high mortality rates and often accompanied by multiple-organ dysfunction. During sepsis, respiratory system may be affected and possibly result in acute respiratory distress syndrome (ARDS). Toll-like receptors (TLRs), as a first line defense against invading pathogens, seem to be highly expressed in septic states. Therefore, expression of TLRs in the lungs of a sepsis animal model could indicate the involvement of the respiratory system and appear as a severity index of the clinical course.A total of 72 C57BL/6J mice, aged 12-14 weeks, were studied. The animals were divided into 3 sepsis (S) groups (24h, 48h and 72h) and 3 control (C) groups (24h, 48h and 72h), each consisting of 12 mice. The S-groups were subjected to cecal ligation and puncture (CLP) while the C-groups had a sham operation performed. Blood samples were drawn from all groups. Total blood count analysis was performed along with the measurement of certain biochemical markers. Additionally, lung tissues were harvested and the expression of TLRs, namely TLR 2, TLR 3, TLR 4 and TLR 7 were evaluated by means of immunofluorescence (IF) and qRT-PCR (quantitative-Polymerase Chain Reaction). Statistical analysis was performed by using one-way ANOVA followed by student t-test. Results were considered statistically significant when p<0.05.WBCs and lymphocytes were decreased in all S-groups compared to the corresponding C-groups (p<0.05), while RBCs showed a gradual decline in S-groups with the lowest levels appearing in the S72 group. Only, monocytes were higher in S-groups, especially between S48-C48 (p<0.05) and S72-C72 (p<0.05). Creatinine, IL-10 and IL-6 levels were significantly increased in the S-groups compared to the corresponding C-groups (S24 vs C24, S48 vs C48 and S72 vs C72, p<0.05). IF showed that expression of TLRs 2, 3, 4 and 7 was increased in all S-groups compared to the time-adjusted C-groups (p<0.05). Similarly, qRT-PCR revealed that expression of all TLRs was higher in all S-groups compared to their respective C-groups in both lungs and intestine (p<0.05). Comparing lung and intestinal tissues from S-groups, TLRs 2 and 4 were found increased in the lung at 24, 48 and 72 hours (p<0.05), whereas TLR 3 was higher in the intestine at all time points examined (p<0.05). Finally, TLR 7 levels were significantly higher in the intestinal tissues at 24 hours (p<0.0001), while lungs predominated at 48 hours (p<0.0001).TLRs seem to be highly expressed in the lungs of septic mice, therefore suggesting a potential role in the pathogenesis of ARDS during sepsis. While more studies need to be conducted in order to completely understand the underlying mechanisms, TLRs may represent a promising target for establishing novel therapeutic strategies in the treatment of sepsis.
| S-EPMC5685586 | biostudies-literature
Project description:The objective of this study is to: 1) Characterize the innate immune responsiveness of patients with inborn errors in Toll-IL1 receptor signaling pathway (IRAK4, MyD88 deficiencies) compared to healthy subjects, through the analysis of blood leukocytes' transcriptional profiles after stimulation with ligands for the whole set of Toll-like receptors and IL-1Rs plus whole bacteria. 2) Understand the redundancies in TLR pathway in humans. 3) Explore the use of blood profiling approaches to assess the immune status of an individual by using Primary Immune Deficiencies as a proof of principle.
2014-10-26 | GSE25742 | GEO