Dataset Information

The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity.

ABSTRACT: Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-? Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-?, IFN-?, IFN?-1, and TNF-? secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.

SUBMITTER: Ovsyannikova IG

PROVIDER: S-EPMC3924423 | biostudies-literature | 2011 Oct

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity.

Ovsyannikova Inna G IG Haralambieva Iana H IH Vierkant Robert A RA Pankratz V Shane VS Jacobson Robert M RM Poland Gregory A GA

Human genetics 20110319 4

Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. ...[more]

PMID: 21424379

Similar Datasets

Project description:Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella (MMR) vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction for FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans.

Project description:BackgroundThe gram-negative bacterium Bordetella pertussis is an important causative agent of pertussis, an infectious disease of the respiratory tract. After introduction of whole-cell vaccines (wP) in the 1950's, pertussis incidence has decreased significantly. Because wP were found to be reactogenic, in most developed countries they have been replaced by acellular vaccines (aP). We have previously shown a role for Toll-like receptor 4 (Tlr4) in pertussis-infected mice and the pertussis toxin (Ptx)-IgG response in wP-vaccinated children, raising the issue of the relative importance of Tlr4 in wP vaccination of mice. Here we analyze the effects of wP and aP vaccination and B. pertussis challenge, in Tlr4-deficient C3H/HeJ and wild-type C3H/HeOuJ mice. aP consists of Ptx, filamentous hemagglutinin (FHA), and pertactin (Prn).ResultsWe show an important role of Tlr4 in wP and (to a lesser extent) aP vaccination, induction of Th1 and Th17 cells by wP but not aP vaccination, and induction of Th17 cells by infection, confirming data by Higgins et al. (J Immunol 2006, 177:7980-9). Furthermore, in Tlr4-deficient mice, compared to wild-type controls (i) after vaccination only, Ptx-IgG (that was induced by aP but not wP vaccination), FHA-IgG, and Prn-IgG levels were similar, (ii) after infection (only), lung IL-1alpha and IL-1beta expression were lower, (iii) after wP vaccination and challenge, Prn-IgG level and lung IL-5 expression were higher, while lung IL-1beta, TNF-alpha, IFN-gamma, IL-17, and IL-23 expression were lower, and lung pathology was absent, and (iv) after aP vaccination and challenge, Prn-IgG level and lung IL-5 expression were higher, while Ptx-IgG level was lower.ConclusionTlr4 does not influence the humoral response to vaccination (without challenge), plays an important role in natural immunity, wP and aP efficacy, and induction of Th1 and Th17 responses, is critical for lung pathology and enhances pro-inflammatory cytokine production after wP vaccination and challenge, and diminishes Th2 responses after both wP and aP vaccination and challenge. wP vaccination does not induce Ptx-IgG. A role for LPS in the efficacy of wP underlines the usefulness of LPS analogs to improve bacterial subunit vaccines such as aP.

Project description:BackgroundHuman cytomegalovirus (HCMV) is the most common cause of intrauterine infections worldwide. The toll-like receptors (TLRs) have been reported as important factors in immune response against HCMV. Particularly, TLR2, TLR4 and TLR9 have been shown to be involved in antiviral immunity. Evaluation of the role of single nucleotide polymorphisms (SNPs), located within TLR2, TLR4 and TLR9 genes, in the development of human cytomegalovirus (HCMV) infection in pregnant women and their fetuses and neonates, was performed.MethodsThe study was performed for 131 pregnant women, including 66 patients infected with HCMV during pregnancy, and 65 age-matched control pregnant individuals. The patients were selected to the study, based on serological status of anti-HCMV IgG and IgM antibodies and on the presence of viral DNA in their body fluids. Genotypes in TLR2 2258 A > G, TLR4 896 G > A and 1196 C > T and TLR9 2848 G > A SNPs were determined by self-designed nested PCR-RFLP assays. Randomly selected PCR products, representative for distinct genotypes in TLR SNPs, were confirmed by sequencing. A relationship between the genotypes, alleles, haplotypes and multiple variants in the studied polymorphisms, and the occurrence of HCMV infection in pregnant women and their offsprings, was determined, using a logistic regression model.ResultsGenotypes in all the analyzed polymorphisms preserved the Hardy-Weinberg equilibrium in pregnant women, both infected and uninfected with HCMV (P > 0.050). GG homozygotic and GA heterozygotic status in TLR9 2848 G > A SNP decreased significantly the occurrence of HCMV infection (OR 0.44 95% CI 0.21-0.94 in the dominant model, P ≤ 0.050). The G allele in TLR9 SNP was significantly more frequent among the uninfected pregnant women than among the infected ones (χ2 = 4.14, P ≤ 0.050). Considering other polymorphisms, similar frequencies of distinct genotypes, haplotypes and multiple-SNP variants were observed between the studied groups of patients.ConclusionsTLR9 2848 G > A SNP may be associated with HCMV infection in pregnant women.

Dataset Information

The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity.

Publications

The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets