Identification of novel ACAN mutations in two Chinese families and genotype-phenotype correlation in patients with 74 pathogenic ACAN variations.
Ontology highlight
ABSTRACT: Background
ACAN (OMIM 155760) is located on chromosome 15q26 and encodes the production of aggrecan. Aggrecan is a large chondroitin sulfate proteoglycan with a molecular weight of 254 kDa and contains 2530 amino acids. It is a critical structural component of the extracellular matrix of cartilage, including growth plate, articular, and intervertebral disk cartilage. It plays a key role in bone development.Methods
Here, we describe two pedigrees with loss-of-function variants in ACAN. Whole exome sequencing was performed for the probands from each family. We illustrate the clinical variability associated with ACAN variants.Results
The proband of pedigree A manifested short stature, relative macrocephaly, mild flat nasal bridge, low-set ears, short neck, and short thumbs. The proband of pedigree B had short height, abnormal vertebral development, and central precocious puberty. By trio-based whole exome sequencing and in silico analyses, we identified two de novo heterozygous variants of ACAN: NM_013227.4: c.116dupT, p.Arg40Glufs*51 and NM_013227.4: c.2367delC, p.Ser790Glnfs*20 (accession number: AC103982.10).Conclusion
The clinical manifestations of ACAN gene variants are diverse. ACAN gene variants are important genetic factors for short stature and should be considered as the differential diagnosis of children with idiopathic short stature (ISS).
SUBMITTER: Wei M
PROVIDER: S-EPMC8606199 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:BackgroundThis study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.MethodsWhole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ 2- and Fisher's tests were used to analyze the genotype-phenotype correlations.Results(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype-phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021).ConclusionsThis study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.
| S-EPMC7010634 | biostudies-literature
Project description:Objective: Mutations in the ACAN gene have been reported to cause short stature. However, the prevalence estimates of pathogenic ACAN variants in individuals with short stature vary, and the correlation between ACAN genotype and clinical phenotype remain to be evaluated. To determine the prevalence of ACAN variants among Chinese people with short stature and analyze the relationship between genotype and main clinical manifestations of short stature and advanced bone age among patients with ACAN variants. Methods: We performed next-generation sequencing-based genetic analyses on 442 individuals with short stature. ACAN variants were summarized, previously reported cases were retrospectively analyzed, and an association analysis between genotype and phenotype was conducted. Result: We identified 15 novel and two recurrent ACAN gene variants in 16 different pedigrees that included index patients with short stature. Among the patients with ACAN variants, 12 of 18 had advanced bone age and 7 of 18 received growth hormone therapy, 5 (71.4%) of whom exhibited variable levels of height standard deviation score improvement. Further analysis showed that patients with ACAN truncating variants had shorter height standard deviation scores (p = 0.0001) and larger bone age-chronological age values (p = 0.0464). Moreover, patients in this Asian population had a smaller mean bone age-chronological age value than those that have been determined in European and American populations (p = 0.0033). Conclusion: Our data suggest that ACAN mutation is a common cause of short stature in China, especially among patients with a family history of short stature but also among those who were born short for their gestational age without a family history. Patients with truncating variants were shorter in height and had more obvious advanced bone age, and the proportion of patients with advanced bone age was lower in this Asian population than in Europe and America.
| S-EPMC9127616 | biostudies-literature
Project description:In the present study, genotype-phenotype correlations in eight Dutch DFNB8/10 families with compound heterozygous mutations in TMPRSS3 were addressed. We compared the phenotypes of the families by focusing on the mutation data. The compound heterozygous variants in the TMPRSS3 gene in the present families included one novel variant, p.Val199Met, and four previously described pathogenic variants, p.Ala306Thr, p.Thr70fs, p.Ala138Glu, and p.Cys107Xfs. In addition, the p.Ala426Thr variant, which had previously been reported as a possible polymorphism, was found in one family. All affected family members reported progressive bilateral hearing impairment, with variable onset ages and progression rates. In general, the hearing impairment affected the high frequencies first, and sooner or later, depending on the mutation, the low frequencies started to deteriorate, which eventually resulted in a flat audiogram configuration. The ski-slope audiogram configuration is suggestive for the involvement of TMPRSS3. Our data suggest that not only the protein truncating mutation p.T70fs has a severe effect but also the amino acid substitutions p.Ala306Thr and p.Val199Met. A combination of two of these three mutations causes prelingual profound hearing impairment. However, in combination with the p.Ala426Thr or p.Ala138Glu mutations, a milder phenotype with postlingual onset of the hearing impairment is seen. Therefore, the latter mutations are likely to be less detrimental for protein function. Further studies are needed to distinguish possible phenotypic differences between different TMPRSS3 mutations. Evaluation of performance of patients with a cochlear implant indicated that this is a good treatment option for patients with TMPRSS3 mutations as satisfactory speech reception was reached after implantation.
| S-EPMC3214237 | biostudies-literature
Project description:PurposeTo describe the clinical and genetic findings in two Chinese families with retinitis pigmentosa (RP).MethodsTwo unrelated families were examined clinically. After informed consent was obtained, genomic DNA was extracted from the venous blood of all participants. Genotyping and haplotyping analysis was performed on the known genetic loci for autosomal dominant retinitis pigmentosa (adRP) with a panel of polymorphic markers in the two families, and then mutation screening of all coding exons of the RHO gene was performed by direct sequencing of PCR-amplified DNA fragments. Whenever substitutions were identified in a patient, restriction fragment length polymorphism analysis was performed on all available family members and on 100 normal controls.ResultsClinical examination and pedigree analysis revealed two four-generation families (83 and 112) with adRP. A significant two-point linkage odd disequilibrium (LOD) score was generated at marker D3S1292 (Zmax=1.90, θ=0) for family 83 and (Zmax=2.77, θ=0) for family 112, respectively, and further linkage and haplotype studies confined the disease locus to 3q21-22 where the RHO gene is located. Mutation screening of the RHO gene in the two families revealed a G→C transversion at position 505 (p.A169P) of the cDNA sequence in family 83 and a C→A transversion at position 1040 (p.P347Q) of the cDNA in family 112. The novel p.A169P and recurrent p.P347Q mutations cosegregated with the phenotypes of the two families. Secondary structure prediction suggested that the mutant rhodopsin 169P led to significant secondary structure changes between residues 165 and 169, which may interfere with the correct folding of the transmembrane domain.ConclusionsTwo mutations of the RHO gene were identified in two Chinese families with adRP. Our findings further suggest codon 347 is the mutation hotspot of the RHO.
| S-EPMC3534141 | biostudies-literature
Project description:PurposeTo describe the clinical and genetic findings in two Chinese families with aniridia and other ocular abnormalities.MethodsTwo unrelated families were examined clinically. After informed consent was obtained, genomic DNA was extracted from the venous blood of all participants. Mutation screening of all exons of the PAX6 (paired box gene 6) gene was performed by direct sequencing of PCR-amplified DNA fragments. Multiplex ligation-dependent probe amplification (MLPA) was performed to detect large deletions. Linkage analysis was used to validate the large deletions revealed by MLPA in all available family members.ResultsClinical examination and pedigree analysis revealed one four-generation family (85) and one three- generation family (86) with total aniridia, congenital cataracts, foveal hypoplasia, and glaucoma. No mutation in PAX6 was identified after PCR-sequencing. Through MLPA analysis, a large deletion including the whole PAX6 gene, DKFZp686k1684 (hypothetical LOC440034), and the RCN1 (reticulocalbin 1) gene was detected in family 85; a 3' deletion to the PAX6 gene including the ELP4 (elongator complex protein 4) and the DCDC1 (doublecortin domain containing 1) gene was identified in family 86.The two large deletions were confirmed with linkage analysis and the "loss of heterozygous" in the different PAX6 regions were co-segregated with the phenotype of the two families, respectively.ConclusionsPatients with the PAX6 contiguous gene deletion, including the RCN1 gene, presented more severe vision impairments than those carrying the PAX6 3' deletion. Large deletions may account for several Chinese families and sporadic cases with aniridia and screening for these kinds of alterations should be included in aniridia patients' analyses.
| S-EPMC3044699 | biostudies-literature
Project description:Heterogeneity in clinical manifestations is a well-known feature in Long QT Syndrome (LQTS). The extent of this phenomenon became evident in families wherein both symptomatic and asymptomatic family members are reported. The study hence warrants genetic testing and/or screening of family members of LQTS probands for risk stratification and prediction. Of the 46 families screened, 18 probands revealed novel variations/compound heterozygosity in the gene/s screened. Families 1-4 revealed probands carrying novel variations in KCNQ1 gene along with compound heterozygosity of risk genotypes of the SCN5A, KCNE1 and NPPA gene/s polymorphisms screened. It was also observed that families- 5, 6 and 7 were typical cases of "anticipation" in which both mother and child were diagnosed with congenital LQTS (cLQTS). Families- 16 and 17 represented aLQTS probands with variations in IKs and INa encoding genes. First degree relatives (FDRs) carrying the same haplotype as the proband were also identified which may help in predictive testing and management of LQTS. Most of the probands exhibiting a family history were found to be genetic compounds which clearly points to the role of cardiac genes and their modifiers in a recessive fashion in LQTS manifestation.
| S-EPMC4867973 | biostudies-literature
Project description:PurposeTo report novel transforming growth factor beta-induced (TGFBI) mutations responsible for lattice corneal dystrophy (LCD), the associated genotype-phenotype correlation, and structural changes in the mutant proteins in three Chinese families.MethodsThree unrelated Chinese families were diagnosed as Type I LCD. Mutations in TGFBI were detected by sequencing all of the 17 exons and splice sites of the gene. Phenotype, including corneal erosions, and opacification in the families were compared. Structural changes of the mutant proteins were modeled. One hundred healthy volunteers were recruited as controls for sequence analysis of TGFBI.ResultsTwo novel mutations, c.(1702G>C and 1706T>A; p.Arg514Pro and Phe515Leu) in TGFBI were identified in Family 1. Two known hotspot mutations, c. 531C>T (p. Arg124Cys) and c.1876A>G (p.His572Arg), were revealed in Family 2 and Family 3, respectively. Sequence analysis in the 100 healthy control subjects, the unaffected members in Family 1, and evolutionary alignment showed that the novel mutations occurred in the conserved amino acids. Structural modeling revealed changes in the 2nd structure of the mutant proteins, but did not detect gross structural changes. Mutations c.(1702G>C and 1706T>A; p.Arg514Pro and Phe515Leu) and the c. 531C>T (p. Arg124Cys) were present in the corneas with sever opacification.ConclusionsThe novel mutations c.(1702G>C and 1706T>A; p.Arg514Pro and Phe515Leu), c. 531C>T (p. Arg124Cys), c.1876A>G (p.His572Arg) in TGFBI were responsible for LCD in the 3 families. Mutations c.(1702G>C and 1706T>A) (p.Arg514Pro and Phe515Leu) and the c. 531C>T (p. Arg124Cys) were associated with more severe LCD phenotypes in the families. These results provide more data for molecular diagnosis and prognosis of the disease.
| S-EPMC2822555 | biostudies-literature
Project description:IntroductionMutations in USH2A cause both isolated Retinitis Pigmentosa (RP) and Usher syndrome (that implies RP and hearing impairment). One of the most frequent variants identified in this gene and among these patients is the p.(Cys759Phe) change. However, the pathogenic role of this allele has been questioned since it was found in homozygosity in two healthy siblings of a Spanish family. To assess the causative role of USH2A p.(Cys759Phe) in autosomal recessive RP (ARRP) and Usher syndrome type II (USH2) and to establish possible genotype-phenotype correlations associated with p.(Cys759Phe), we performed a comprehensive genetic and clinical study in patients suffering from any of the two above-mentioned diseases and carrying at least one p.(Cys759Phe) allele.Materials and methodsDiagnosis was set according to previously reported protocols. Genetic analyses were performed by using classical molecular and Next-Generation Sequencing approaches. Probands of 57 unrelated families were molecularly studied and 63 patients belonging to these families were phenotypically evaluated.ResultsMolecular analysis characterized 100% of the cases, identifying: 11 homozygous patients for USH2A p.(Cys759Phe), 42 compound heterozygous patients (12 of them with another missense USH2A pathogenic variant and 30 with a truncating USH2A variant), and 4 patients carrying the p.(Cys759Phe) allele and a pathogenic variant in another RP gene (PROM1, CNGB1 or RP1). No additional causative variants were identified in symptomatic homozygous patients. Statistical analysis of clinical differences between zygosity states yielded differences (p≤0.05) in age at diagnosis of RP and hypoacusis, and progression of visual field loss. Homozygosity of p.(Cys759Phe) and compound heterozygosity with another USH2A missense variant is associated with ARRP or ARRP plus late onset hypoacusis (OR = 20.62, CI = 95%, p = 0.041).ConclusionsThe present study supports the role of USH2A p.(Cys759Phe) in ARRP and USH2 pathogenesis, and demonstrates the clinical differences between different zygosity states. Phenotype-genotype correlations may guide the genetic characterization based upon specific clinical signs and may advise on the clinical management and prognosis based upon a specific genotype.
| S-EPMC6005481 | biostudies-literature
Project description:Alternating hemiplegia of childhood (AHC) is a rare and severe neurological disorder. ATP1A3 was recently identified as the causative gene. Here we report the first genetic study in Chinese AHC cohort. We performed whole-exome sequencing on three trios and three unrelated patients, and screened additional 41 typical cases and 100 controls by PCR-Sanger sequencing. ATP1A3 mutations were detected in 95.7% of typical AHC patients. At least 93.3% were de novo. Four late onset, atypical AHC patients were also mutation positive, suggesting the need for testing ATP1A3 mutations in atypical cases. Totally, 13 novel missense mutations (T370N, G706R, L770R, T771N, T771I, S772R, L802P, D805H, M806K, P808L, I810N, L839P and G893R) were identified in our study. By homology modeling of the mutant protein structures and calculation of an extensive list of molecular features, we identified two statistically significant molecular features, solvent accessibility and distance to metal ion, that distinguished disease-associated mutations from neutral variants. A logistic regression classifier achieved 92.9% accuracy by the average of 100 times of five-fold cross validations. Genotype-phenotype correlation analysis showed that patients with epilepsy were more likely to carry E815K mutation. In summary, ATP1A3 is the major pathogenic gene of AHC in Chinese patients; mutations have distinctive molecular features that discriminate them from neutral variants and are correlated with phenotypes.
| S-EPMC4026576 | biostudies-literature
Project description:X-linked Retinitis Pigmentosa (XLRP) accounts for 10-20% of all RP cases, and represents the most severe subtype of this disease. Mutations in the Retinitis Pigmentosa GTPase Regulator (RPGR) gene are the most common causes of XLRP, accounting for over 70-75% of all XLRP cases. In this work, we analyzed all the exons of RPGR gene with Sanger sequencing in seven Chinese XLRP families, two of these with a provisional diagnosis of adRP but without male-to-male transmission. Three novel deletions (c.2233_34delAG; c.2236_37delGA and c.2403_04delAG) and two known nonsense mutations (c.851C→G and c.2260G→T) were identified in five families. Two novel deletions (c.2233_34delAG and c.2236_37delGA) resulted in the same frame shift (p.E746RfsX22), created similar phenotype in Family 3 and 4. The novel deletion (c.2403_04delAG; p.E802GfsX31) resulted in both XLRP and x-linked cone-rod dystrophy within the male patients of family 5, which suggested the presence of either genetic or environmental modifiers, or both, play a substantial role in disease expression. Genotype-phenotype correlation analysis suggested that (1) both patients and female carriers with mutation in Exon 8 (Family 1) manifest more severe disease than did those with ORF15 mutations (Family 2&3&4); (2) mutation close to downstream of ORF15 (Family 5) demonstrate the early preferential loss of cone function with moderate loss of rod function.
| S-EPMC3893273 | biostudies-literature