Browse
Submit Data
Databases
API
Help

Dataset Information

30 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Analyzing gut microbiota composition in individual Anopheles mosquitoes after experimental treatment.

ABSTRACT: The microbiota of Anopheles mosquitoes influences malaria transmission. Antibiotics ingested during a blood meal impact the mosquito microbiome and malaria transmission, with substantial differences between drugs. Here, we assessed if amoxicillin affects the gut mosquito microbiota. We collected Anopheles larvae in Burkina Faso, kept them in semi-field conditions, and offered a blood meal to adult females. We tested the impact of blood supplementation with two alternative amoxicillin preparations on microbiota composition, determined by high-throughput sequencing in individual gut samples. Our analysis detected four major genera, Elizabethkingia, Wigglesworthia, Asaia, and Serratia. The antibiotic treatment significantly affected overall microbiota composition, with a specific decrease in the relative abundance of Elizabethkingia and Asaia during blood digestion. Besides its interest on the influence of amoxicillin on the mosquito microbiota, our study proposes a thorough approach to report negative-control data of high-throughput sequencing studies on samples with a reduced microbial load.

SUBMITTER: Fofana A

PROVIDER: S-EPMC8637483 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

Long-term blood-free rearing of Anopheles mosquitoes with no effect on fitness, Plasmodium infectivity nor microbiota composition

Project description: Not available

| S-EPMC11341565 | biostudies-literature

Cinobufacini ameliorates experimental colitis via modulating the composition of gut microbiota.

Project description:BACKGROUND:Cinobufacini, the sterilized hot water extraction of dried toad skin, has been widely used in the treatment of inflammation and cancers. Recently we found cinobufacini could ameliorate dextran sulfate sodium (DSS)-induced colitis in mice, but the underlying mechanism was not fully understood. In current study, we explored the effect of cinobufacini on gut microbiota in DSS-induced acute colitic mouse model by pyrosequencing of colonic contents. METHODS:C57BL/6 mice were supplied with normal or 3.0% DSS containing drinking water. DSS-treat mice were gavaged daily either with vehicle (water) or cinobufacini (10.0 or 30.0 mg/kg) for 7 days. The composition of the gut microbiota was assessed by analyzing 16S rRNA gene sequences. RESULTS:Our data indicated that cinobufacini reversed DSS-induced gut dysbiosis and enhanced intestinal barrier integrity. Moreover, changing of some specific microbial groups such as Proteobacteria and Bacteroides was closely correlated with the re-establishment of intestinal equilibrium and the recovery of intestinal function. CONCLUSION:Cinobufacini prevents colitis in mice by modifying the composition and function of gut microbiota. The current study provides additional mechanistic insight in the therapeutic effect of cinobufacini treatment and may pave the way for clinical application of cinobufacini in colitis therapy.

| S-EPMC6768468 | biostudies-literature

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

The environment and species affect gut bacteria composition in laboratory co-cultured Anopheles gambiae and Aedes albopictus mosquitoes.

Project description:The midgut microbiota of disease vectors plays a critical role in the successful transmission of human pathogens. The environment influences the microbiota composition; however, the relative mosquito-species contribution has not been rigorously disentangled from the environmental contribution to the microbiota structure. Also, the extent to which the microbiota of the adult sugar food source and larval water can predict that of the adult midgut and vice versa is not fully understood. To address these relationships, larvae and adults of Anopheles gambiae and Aedes albopictus were either reared separately or in a co-rearing system, whereby aquatic and adult stages of both species shared the larval water and sugar food source, respectively. Despite being reared under identical conditions, clear intra- and interspecies differences in midgut microbiota-composition were observed across seven cohorts, collected at different time points over a period of eight months. Fitting a linear model separately for each OTU in the mosquito midgut showed that two OTUs significantly differed between the midguts of the two mosquito species. We also show an effect for the sugar food source and larval water on the adult midgut microbiota. Our findings suggest that the mosquito midgut microbiota is highly dynamic and controlled by multiple factors.

| S-EPMC7042291 | biostudies-literature

Mosquitoes rely on their gut microbiota for development.

Project description:Field studies indicate adult mosquitoes (Culicidae) host low diversity communities of bacteria that vary greatly among individuals and species. In contrast, it remains unclear how adult mosquitoes acquire their microbiome, what influences community structure, and whether the microbiome is important for survival. Here, we used pyrosequencing of 16S rRNA to characterize the bacterial communities of three mosquito species reared under identical conditions. Two of these species, Aedes aegypti and Anopheles gambiae, are anautogenous and must blood-feed to produce eggs, while one, Georgecraigius atropalpus, is autogenous and produces eggs without blood feeding. Each mosquito species contained a low diversity community comprised primarily of aerobic bacteria acquired from the aquatic habitat in which larvae developed. Our results suggested that the communities in Ae. aegypti and An. gambiae larvae share more similarities with one another than with G. atropalpus. Studies with Ae. aegypti also strongly suggested that adults transstadially acquired several members of the larval bacterial community, but only four genera of bacteria present in blood fed females were detected on eggs. Functional assays showed that axenic larvae of each species failed to develop beyond the first instar. Experiments with Ae. aegypti indicated several members of the microbial community and Escherichia coli successfully colonized axenic larvae and rescued development. Overall, our results provide new insights about the acquisition and structure of bacterial communities in mosquitoes. They also indicate that three mosquito species spanning the breadth of the Culicidae depend on their gut microbiome for development.

| S-EPMC4083365 | biostudies-literature

Denosumab Regulates Gut Microbiota Composition and Cytokines in Dinitrobenzene Sulfonic Acid (DNBS)-Experimental Colitis.

Project description:The pro-inflammatory mediator receptor activator of nuclear factor-kappa B ligand (RANKL) plays a significant role in the development of rheumatoid arthritis; however, its role in inflammatory bowel disease is unknown. Genome-wide association meta-analysis for Crohn's disease (CD) identified a variant near the TNFSF11 gene that encodes RANKL and CD risk allele increased expression of RANKL in specific cell lines. This study aims to elucidate if the RANKL inhibitor denosumab can reduce the severity of experimental colitis and modify the gut microbiota composition using murine dinitrobenzenesulfonic acid (DNBS)-experimental model of colitis mimicking CD. In colitic conditions, denosumab treatment significantly decreased the pro-inflammatory cytokines IL-6, IL-1β, and TNF-α within the colonic mucosa. Moreover, colitis was accompanied by disruption of gut microbiota, and preventative treatment with denosumab modulated this disruption. Denosumab treatment also modified the alpha- and beta diversity of colonic mucosa and fecal microbiota. These results provide a rationale for considering denosumab as a future potential therapy in CD; however, more detailed experimental and clinical studies are warranted.

| S-EPMC7331113 | biostudies-literature

Deficiency of Dietary Fiber Modulates Gut Microbiota Composition, Neutrophil Recruitment and Worsens Experimental Colitis.

Project description:Ulcerative colitis is an inflammatory disease of the colon that is associated with colonic neutrophil accumulation. Recent evidence indicates that diet alters the composition of the gut microbiota and influences host-pathogen interactions. Specifically, bacterial fermentation of dietary fiber produces metabolites called short-chain fatty acids (SCFAs), which have been shown to protect against various inflammatory diseases. However, the effect of fiber deficiency on the key initial steps of inflammation, such as leukocyte-endothelial cell interactions, is unknown. Moreover, the impact of fiber deficiency on neutrophil recruitment under basal conditions and during inflammation in vivo is unknown. Herein, we hypothesized that a fiber-deficient diet promotes an inflammatory state in the colon at baseline and predisposes the host to more severe colitis pathology. Mice fed a no-fiber diet for 14 days showed significant changes in the gut microbiota and exhibited increased neutrophil-endothelial interactions in the colonic microvasculature. Although mice fed a no-fiber diet alone did not have observable colitis-associated symptoms, these animals were highly susceptible to low dose (0.5%) dextran sodium sulphate (DSS)-induced model of colitis. Supplementation of the most abundant SCFA, acetate, prevented no-fiber diet-mediated enrichment of colonic neutrophils and colitis pathology. Therefore, dietary fiber, possibly through the actions of acetate, plays an important role in regulating neutrophil recruitment and host protection against inflammatory colonic damage in an experimental model of colitis.

| S-EPMC7940676 | biostudies-literature

Composition profile of gut microbiota uptaking plant-derived nanoparticles

Project description:Human diet emerges as a pivotal determinant of gut microbiota composition and function. Identification of the bacterial taxa targeted by diet derived factors with causal beneficial rather than detrimental effects on therapy and their mechanism of action is challenging but necessary for future clinical progress. The germ free mice colonized with human gut bacteria and four-plants derived nanoparticles uptaking bacteria were sorted with flow cytometry and identified with 16s rRNA next-generation sequencing.

2024-11-26 | GSE229897 | GEO

Composition of human skin microbiota affects attractiveness to malaria mosquitoes.

Project description:The African malaria mosquito Anopheles gambiae sensu stricto continues to play an important role in malaria transmission, which is aggravated by its high degree of anthropophily, making it among the foremost vectors of this disease. In the current study we set out to unravel the strong association between this mosquito species and human beings, as it is determined by odorant cues derived from the human skin. Microbial communities on the skin play key roles in the production of human body odour. We demonstrate that the composition of the skin microbiota affects the degree of attractiveness of human beings to this mosquito species. Bacterial plate counts and 16S rRNA sequencing revealed that individuals that are highly attractive to An. gambiae s.s. have a significantly higher abundance, but lower diversity of bacteria on their skin than individuals that are poorly attractive. Bacterial genera that are correlated with the relative degree of attractiveness to mosquitoes were identified. The discovery of the connection between skin microbial populations and attractiveness to mosquitoes may lead to the development of new mosquito attractants and personalized methods for protection against vectors of malaria and other infectious diseases.

| S-EPMC3247224 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data