Novel rhino-like SHJH hr mice with thyroid dysfunction.
Ontology highlight
ABSTRACT:
SUBMITTER: Li YC
PROVIDER: S-EPMC8645886 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:The purpose of this work was to investigate the distinct and common metabolic features of the malignant and benign thyroid lesions in reference to the non-transformed tissue from the contralateral gland (chronic thyroiditis and colloid goiter). 1H HR MAS NMR spectra of 38 malignant lesions, 32 benign lesions and 112 samples from the non-tumoral tissue (32 from chronic thyroiditis and 80 samples from colloid goiter) were subjected both to multivariate and univariate analysis. The increased succinate, glutamine, glutathione, serine/cysteine, ascorbate, lactate, taurine, threonine, glycine, phosphocholine/glycerophosphocholine and decreased lipids were found in both lesion types in comparison to either colloid goiter or chronic thyroiditis. The elevated glutamate and choline, and reduced citrate and glucose were additionally evident in these lesions in reference to goiter, while the increased myo-inositol-in comparison to thyroiditis. The malignant lesions were characterized by the higher alanine and lysine levels than colloid goiter and thyroiditis, while scyllo-inositol was uniquely increased in the benign lesions (not in cancer) in comparison to both non-tumoral tissue types. Moreover, the benign lesions presented with the unique increase of choline in reference to thyroiditis (not observed in the cancerous tissue). The metabolic heterogeneity of the non-tumoral tissue should be considered in the analysis of metabolic reprogramming in the thyroid lesions.
| S-EPMC7809111 | biostudies-literature
Project description:ObjectiveThe risk of thrombosis in myeloproliferative neoplasms, such as primary myelofibrosis varies depending on the type of key driving mutation (JAK2 [janus kinase 2], CALR [calreticulin], and MPL [myeloproliferative leukemia protein or thrombopoietin receptor]) and the accompanying mutations in other genes. In the current study, we sought to examine the propensity for thrombosis, as well as platelet activation properties in a mouse model of primary myelofibrosis induced by JAK2V617F (janus kinase 2 with valine to phenylalanine substitution on codon 617) mutation. Approach and Results: Vav1-hJAK2V617F transgenic mice show hallmarks of primary myelofibrosis, including significant megakaryocytosis and bone marrow fibrosis, with a moderate increase in red blood cells and platelet number. This mouse model was used to study responses to 2 models of vascular injury and to investigate platelet properties. Platelets derived from the mutated mice have reduced aggregation in response to collagen, reduced thrombus formation and thrombus size, as demonstrated using laser-induced or FeCl3-induced vascular injury models, and increased bleeding time. Strikingly, the mutated platelets had a significantly reduced number of dense granules, which could explain impaired ADP secretion upon platelet activation, and a diminished second wave of activation.ConclusionsTogether, our study highlights for the first time the influence of a hyperactive JAK2 on platelet activation-induced ADP secretion and dense granule homeostasis, with consequent effects on platelet activation properties.
| S-EPMC7605151 | biostudies-literature
Project description:We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.
| S-EPMC4160947 | biostudies-literature
Project description:The tissue metabolomic characteristics associated with endometrial cancer (EC) at different grades were studied using high resolution (400 MHz) magic angle spinning (HR-MAS) proton spectroscopy. The metabolic profiles were obtained from 64 patients (14 with grade 1 (G1), 33 with grade 2 (G2) and 17 with grade 3 (G3) tumors) and compared with the profile acquired from 10 patients with the benign disorders. OPLS-DA revealed increased valine, isoleucine, leucine, hypotaurine, serine, lysine, ethanolamine, choline and decreased creatine, creatinine, glutathione, ascorbate, glutamate, phosphoethanolamine and scyllo-inositol in all EC grades in reference to the non-transformed tissue. The increased levels of taurine was additionally detected in the G1 and G2 tumors in comparison to the control tissue, while the elevated glycine, N-acetyl compound and lactate-in the G1 and G3 tumors. The metabolic features typical for the G1 tumors are the increased dimethyl sulfone, phosphocholine, and decreased glycerophosphocholine and glutamine levels, while the decreased myo-inositol level is characteristic for the G2 and G3 tumors. The elevated 3-hydroxybutyrate, alanine and betaine levels were observed in the G3 tumors. The differences between the grade G1 and G3 malignances were mainly related to the perturbations of phosphoethanolamine and phosphocholine biosynthesis, inositol, betaine, serine and glycine metabolism. The statistical significance of the OPLS-DA modeling was also verified by an univariate analysis. HR-MAS NMR based metabolomics provides an useful insight into the metabolic reprogramming in endometrial cancer.
| S-EPMC8438077 | biostudies-literature
Project description:The thyroid hormones act on nearly every cell in the body. Moreover, the thyroid gland continuously interacts with the ovaries, and the thyroid hormones are involved in almost all phases of reproduction. Thyroid dysfunctions are relatively common among women of reproductive age, and can affect fertility in various ways, resulting in anovulatory cycles, high prolactin levels, and sex hormone imbalances. Undiagnosed and untreated thyroid disease can be a cause of subfertility. Subclinical hypothyroidism (SCH), also known as mild thyroid failure, is diagnosed when peripheral thyroid hormone levels are within the normal reference laboratory range, but serum thyroid-stimulating hormone levels are mildly elevated. Thyroid autoimmunity (TAI) is characterized by the presence of anti-thyroid antibodies, which include anti-thyroperoxidase and anti-thyroglobulin antibodies. SCH and TAI may remain latent, asymptomatic, or even undiagnosed for an extended period. It has also been demonstrated that controlled ovarian hyperstimulation has a significant impact on thyroid function, particularly in women with TAI. In the current review, we describe the interactions between thyroid dysfunctions and subfertility, as well as the proper work-up and management of thyroid dysfunctions in subfertile women.
| S-EPMC4724596 | biostudies-literature
Project description:Wild vertebrate populations all over the globe are in decline, with poaching being the second-most-important cause. The high poaching rate of rhinoceros may drive these species into extinction within the coming decades. Some stakeholders argue to lift the ban on international rhino horn trade to potentially benefit rhino conservation, as current interventions appear to be insufficient. We reviewed scientific and grey literature to scrutinize the validity of reasoning behind the potential benefit of legal horn trade for wild rhino populations. We identified four mechanisms through which legal trade would impact wild rhino populations, of which only the increased revenue for rhino farmers could potentially benefit rhino conservation. Conversely, the global demand for rhino horn is likely to increase to a level that cannot be met solely by legal supply. Moreover, corruption is omnipresent in countries along the trade routes, which has the potential to negatively affect rhino conservation. Finally, programmes aimed at reducing rhino horn demand will be counteracted through trade legalization by removing the stigma on consuming rhino horn. Combining these insights and comparing them with criteria for sustainable wildlife farming, we conclude that legalizing rhino horn trade will likely negatively impact the remaining wild rhino populations. To preserve rhino species, we suggest to prioritize reducing corruption within rhino horn trade, increasing the rhino population within well-protected 'safe havens' and implementing educational programmes and law enforcement targeted at rhino horn consumers.
| S-EPMC7273149 | biostudies-literature
Project description:BackgroundCurrent screening guidelines for colorectal cancer (CRC) do not consider thyroid dysfunction as a risk factor for disease development. We sought to determine the risk of developing CRC in patients with thyroid dysfunction, with and without thyroid hormone replacement (THR).MethodsWe conducted a nested case-control study using a large population-based medical records database from the United Kingdom. Study case patients were defined as those with any medical code of CRC. Subjects with familial colorectal cancer syndromes or inflammatory bowel disease (IBD) were excluded. For every case patient, four eligible control patients matched on age, sex, practice site, and duration of follow-up before index date were selected using incidence density sampling. Exposure was THR therapy before index date. We further divided the THR unexposed group into patients with hypothyroidism (TSH > 4 mg/dl), patients with hyperthyroidism (TSH < 0.4 mg/dl), and subjects without documented thyroid abnormality. The adjusted odds ratios (ORs) and 95% confidence intervals (CIs) for CRC were estimated using conditional logistic regression. All statistical tests were two-sided.ResultsWe identified 20990 CRC patients and 82054 control patients. The adjusted odds ratio for CRC associated with THR was 0.88 (95% CI = 0.79 to 0.99, P = .03) and 0.68 (95% CI = 0.55 to 0.83, P < .001) for treatment initiated five to 10 years and more than 10 years before index date, respectively. This protective association increased with cumulative duration of therapy. In contrast, hyperthyroidism (adjusted OR = 1.21, 95% CI = 1.08 to 1.36, P = .001) or untreated hypothyroidism (adjusted OR = 1.16, 95% CI = 1.08 to 1.24, P < .001) were associated with increased risk of CRC.ConclusionLong-term THR is associated with a decreased risk of CRC. Hyperthyroidism and untreated hypothyroidism are associated with modestly elevated risk of CRC.
| S-EPMC4838062 | biostudies-literature
Project description:Patients with metastatic differentiated thyroid cancer (DTC) may be prepared using either thyroid-stimulating hormone withdrawal (THW) or recombinant human thyroid-stimulating hormone (rhTSH) injections before 131I administration for treatment. The objective of this study was to compare the absorbed dose to the critical organs and tumors determined by 124I PET/CT-based dosimetry for 131I therapy of metastatic DTC when the same patient was prepared with and imaged after both THW and rhTSH injections. Methods: Four DTC patients at MedStar Washington Hospital Center were first prepared using the rhTSH method and imaged by 124I PET/CT at 2, 24, 48, 72, and 96 h after administration of approximately 30-63 MBq of 124I. After 5-8 wk, the same patients were prepared using the THW method and imaged as before. The 124I PET/CT images acquired as part of a prospective study were used to perform retrospective dosimetric calculations for 131I therapy for the normal organs with the dosimetry package 3D-RD. The absorbed doses from 131I for the lungs, liver, heart, kidneys, and bone marrow were obtained for each study (rhTSH and THW). Twenty-two lesions in 3 patients were identified. The contours were drawn on each PET image of each study. Time-integrated activity coefficients were calculated and used as input in OLINDA/EXM sphere dose calculator to obtain the absorbed dose to tumors. Results: The THW-to-rhTSH organ absorbed dose ratio averaged over 5 organs for the first 3 patients was 1.5, 2.5, and 0.64, respectively, and averaged over 3 organs for the fourth patient was 1.1. The absorbed dose per unit administered activity to the bone marrow was 0.13, 0.086, 0.33, and 0.068 mGy/MBq after rhTSH and 0.11, 0.14, 0.22, and 0.080 mGy/MBq after THW for each patient, respectively. With the exception of 3 lesions of 1 patient, the absorbed dose per unit administered activity of 131I was higher in the THW study than in the rhTSH study. The ratio of the average tumor absorbed dose after stimulation by THW compared with stimulation by rhTSH injections was 3.9, 27, and 1.4 for patient 1, patient 2, and patient 3, respectively. The ratio of mean tumor to bone marrow absorbed dose per unit administered activity of 131I, after THW and rhTSH, was 232 and 62 (patient 1), 12 and 0.78 (patient 2), and 22 and 11 (patient 3), respectively. Conclusion: The results suggest a high patient variability in the overall absorbed dose to the normal organs per MBq of 131I administered, between the 2 TSH stimulation methods. The tumor-to-dose-limiting-organ (bone marrow) absorbed dose ratio, that is, the therapeutic index, was higher in the THW-aided than rhTSH-aided administrations. Additional comparison for tumor and normal organ absorbed dose in patients prepared using both methods is needed before definitive conclusions may be drawn regarding rhTSH versus THW patient preparation methods for 131I therapy of metastatic DTC.
| S-EPMC5493009 | biostudies-literature
Project description:Approximately half of people infected with HIV (PWH) exhibit HIV-associated neuropathology (neuroHIV), even when receiving combined antiretroviral therapy. Opiate use is widespread in PWH and exacerbates neuroHIV. While neurons themselves are not infected, they incur sublethal damage and GABAergic disruption is selectively vulnerable to viral and inflammatory factors released by infected/affected glia. Here, we demonstrate diminished K+-Cl- cotransporter 2 (KCC2) levels in primary human neurons after exposure to HIV-1 or HIV-1 proteins ± morphine. Resulting disruption of GABAAR-mediated hyperpolarization/inhibition was shown using genetically-encoded voltage (Archon1) and calcium (GCaMP6f) indicators. The HIV proteins Tat (acting through NMDA receptors) and R5-gp120 (acting via CCR5) but not X4-tropic gp120 (acting via CXCR4), and morphine (acting through μ-opioid receptors) all induced KCC2 loss. We demonstrate that modifying KCC2 levels or function, or antagonizing NMDAR, CCR5 or MOR rescues KCC2 and GABAAR-mediated hyperpolarization/inhibition in HIV, Tat, or gp120 ± morphine-exposed neurons. Using an inducible, Tat-transgenic mouse neuroHIV model, we found that chronic exposure to Tat also reduces KCC2. Our results identify KCC2 as a novel therapeutic target for ameliorating the pathobiology of neuroHIV, including PWH exposed to opiates.
| S-EPMC7685173 | biostudies-literature
Project description:In addition to genomic signaling, Estrogen receptor alpha (ER?) is associated with cell proliferation and survival through extranuclear signaling contributing to endocrine therapy (ET) resistance. However, the relationship between extranuclear ER? and ET resistance has not been extensively studied. We sought to measure extranuclear ER? expression by immunohistochemistry using phosphor-integrated dots (IHC-PIDs) and to assess its predictive value for ET resistance. After quantitative detection of ER? by IHC-PIDs in vitro, we developed "the nearest-neighbor method" to calculate the extranuclear ER?. Furthermore, tissue sections from 65 patients with HR+/HER2- BC were examined by IHC-PIDs, and the total ER?, nuclear ER?, extranuclear ER? PIDs score, and ratio of extranuclear-to-nuclear ER? (ENR) were measured using the novel method. We demonstrate that quantification of ER? using IHC-PIDs exhibited strong correlations to real-time qRT-PCR (r2 = 0.94) and flow cytometry (r2 = 0.98). High ER? ENR was significantly associated with poor overall survival (p = 0.048) and disease-free survival (DFS) (p = 0.007). Multivariate analysis revealed that the ER? ENR was an independent prognostic factor for DFS [hazard ratio, 3.8; 95% CI, 1.4-11.8; p = 0.006]. Our automated measurement has high accuracy to localize and assess extranuclear ER?. A high ER? ENR in HR+/HER2- BC indicates decreased likelihood of benefiting from ET.
| S-EPMC6520781 | biostudies-literature