CircRNA-DURSA regulates trophoblast apoptosis via miR-760-HIST1H2BE axis in unexplained recurrent spontaneous abortion.
Ontology highlight
ABSTRACT:
SUBMITTER: Tang M
PROVIDER: S-EPMC8655312 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:In pregnancy, trophoblast proliferation, migration and invasion are important for the establishment and maintenance of a successful pregnancy. Impaired trophoblast function has been implicated in recurrent spontaneous abortion (RSA), a major complication of pregnancy, but the underlying mechanisms remain unclear. Indoleamine 2,3-dioxygenase (IDO), an enzyme that catabolizes tryptophan along the kynurenine pathway, is highly expressed in the placenta and serum during pregnancy. Here, we identified a novel function of IDO in regulating trophoblast cell proliferation and migration. We showed that IDO expression and activity were decreased in unexplained recurrent spontaneous abortion (URSA) compared to normal pregnancy. Furthermore, blocking IDO in human trophoblast cells led to reduced proliferation and migration, along with decreased STAT3 phosphorylation and MMP9 expression. Increased STAT3 phosphorylation reversed the IDO knockdown-suppressed trophoblast cell proliferation and migration. In addition, the overexpression of IDO promoted cell proliferation and migration, which could be abolished by the STAT3 signaling inhibitor (AG490). Finally, we observed similar reductions of STAT3 phosphorylation and MMP9 expression in URSA patients. These results indicate that the level of IDO expression may be associated with pregnancy-related complications, such as URSA, by affecting trophoblast cell proliferation and migration via the STAT3 signaling pathway.
| S-EPMC4728682 | biostudies-other
Project description:BackgroundSpontaneous abortions (SA) is amongst the most common complications associated with pregnancy in humans, and the underlying causes cannot be identified in roughly half of SA cases. We found miR-135a-5p to be significantly upregulated in SA-associated villus tissues, yet the function it plays in this context has yet to be clarified. This study explored the function of miR-135a-5p and its potential as a biomarker for unexplained SA.MethodRT-qPCR was employed for appraising miR-135a-5p expression within villus tissues with its clinical diagnostic values being assessed using ROC curves. The effects of miR-135a-5p in HTR-8/SVneo cells were analyzed via wound healing, Transwell, flow cytometry, EdU, CCK-8, and tube formation assays. Moreover, protein expression was examined via Western blotting, and interactions between miR-135a-5p and PTPN1 were explored through RIP-PCR, bioinformatics analyses and luciferase reporter assays.ResultsRelative to normal pregnancy (NP), villus tissue samples from pregnancies that ended in unexplained sporadic miscarriage (USM) or unexplained recurrent SA (URSA) exhibited miR-135a-5p upregulation. When this miRNA was overexpressed in HTR-8/SVneo cells, their migration, proliferation, and cell cycle progression were suppressed, as were their tube forming and invasive activities. miR-135a-5p over-expression also downregulated the protein level of cyclins, PTPN1, MMP2 and MMP9. In RIP-PCR assays, the Ago2 protein exhibited significant miR-135a-5p and PTPN1 mRNA enrichment, and dual-luciferase reporter assays indicated PTPN1 to be a bona fide miR-135a-5p target gene within HTR-8/SVneo cells.ConclusionmiR-135a-5p may suppress trophoblast migratory, invasive, proliferative, and angiogenic activity via targeting PTPN1, and it may thus offer value as a biomarker for unexplained SA.
| S-EPMC9128262 | biostudies-literature
Project description:BackgroundMaternally Expressed Gene 3 (MEG3) is expressed at low levels in placental villi during preeclampsia; however, its roles in unexplained recurrent spontaneous abortion (URSA) remain unclear. In this study, we aimed to explore the relationship between MEG3 and URSA.MethodsThe differentially expressed lncRNAs (MEG3) and its downstream genes (RASA1) were identified using bioinformatics analysis of Genomic Spatial Event (GSE) database. The expression levels of MEG3 in embryonic villis (with gestational ages of 49-63 days) and primary trophoblasts were determined using quantitative RT-PCR assay. A mouse model of Embryo implantation, Cell Counting Kit-8 (CCK-8), flow cytometry, and Transwell migration assays were performed to determine the implantation, proliferative, apoptotic, and invasive capacities of trophoblast. The level of phosphorylated core proteins in the RAS-MAPK pathway were analyzed using Western blot assay. The mechanisms of MEG3 in the regulation of RASA1 were studied by RNA pulldown, RNA immunoprecipitation (RIP), DNA pulldown, and chromatin immunoprecipitation (ChIP) assays.ResultsMEG3 had a low expression level in embryonic villis of 102 URSA patients compared with those of 102 normal pregnant women. MEG3 could promote proliferation and invasion, inhibit the apoptosis of primary trophoblast of URSA patients (PT-U cells), as well as promote embryo implantation of mouse. Besides, MEG3 also promoted the phosphorylation of rapidly accelerated fibrosarcoma (Raf), mitogen-activated protein kinase kinase (MEK), and extracellular-signal-regulated kinase (ERK) proteins. The results of RNA pull down and RIP assays showed that MEG3 bound with the enhancer of zeste homolog 2 (EZH2). The DNA pulldown assay revealed that MEG3 could bind to the promoter sequence of the RAS P21 Protein Activator 1 (RASA1) gene. Further, the ChIP assay showed that MEG3 promoted the binding of EZH2 to the promoter region of the RASA1 gene.ConclusionsThe inactivation of MEG3 in embryonic villi association with URSA; MEG3 inhibited the expression of RASA1 by mediating the histone methylation of the promoter of RASA1 gene by EZH2, thereby activating the RAS-MAPK pathway and enhancing the proliferative and invasive capacities of trophoblasts.
| S-EPMC8265043 | biostudies-literature
Project description:The specific causes of recurrent spontaneous abortion (RSA) remain unknown in 37-79% of affected women. The aim of this study was to explore the expression levels of 6 miRNAs in natural killer (NK) cells from the decidua of patients with unexplained RSA (URSA) and to predict the target genes of 3 miRNAs.Two groups were examined: URSA (n=20) and controls (n=20). Flow cytometry analysis was used to identify NK cells isolated from the decidua. Transcriptional levels of miRNA were monitored using quantitative real-time reverse transcription-polymerase chain reaction. Prediction and analysis of mRNA targets of differentially expressed miRNAs were performed using bioinformatics methods.Five miRNAs [miR-34a (+281%, P<0.001), miR-155 (+396%, P<0.001), miR-141 (+142%, P<0.01), miR-125a (+279%, P<0.001), and miR-125b (+185%, P<0.001)] were up-regulated, while miR-24 was down-regulated (-64%, P<0.01) in the URSA group, compared to the control group. This study identified potential miRNA targets: miR-34a-3p/5p, 585/1718 (targets of miR-34a-3p/targets of miR-34a-5p), miR-141-3p/5p, 2270/629 (targets of miR-141-3p/targets of miR-141-5p), and miR-24, 2320 target genes. A total of 140 pathways related to target genes were identified including PI3K-Akt, focal adhesion, MAPK, Wnt, regulation of the actin cytoskeleton, T cell receptor, TGF-?, and estrogen signaling pathways.This study suggests that miR-34a-3p/5p, miR-141-3p/5p, and miR-24 in decidual NK cells could be associated with URSA. These findings might contribute to the panel of diagnostic and prognostic biomarkers with clinical utility, and facilitate the development of new strategies for targeted therapy against URSA.
| S-EPMC4805134 | biostudies-literature
Project description:PurposeThe purpose of this study is to investigate the function of miR-150-5p in URSA.MethodTwenty-six chorionic villous tissues were collected to examine the expression of miR-150-5p and VEGFA by using quantitative polymerase chain reaction (qPCR) and western blot assay, respectively. Transwell assay was conducted to assess the migration and invasion ability of trophoblast cells. The dual-luciferase reporter assay was applied to determine the relationship between miR-150-5p and VEGFA in vitro. Relevant signaling pathway protein expression level was measured via western blot assay. Signaling transduction inhibitor LY294002 was used to block PI3K/AKT/mTOR signaling pathway. Finally, in vivo the effect of miR-150-5p on embryonic absorption rate was evaluated in mice.ResultsClinical samples revealed that miR-150-5p expression was significantly elevated in the villous tissues and serum of URSA patients. Moreover, the overexpressing of miR-150-5p could inhibit both HTR-8/SVneo cell and JAR cell migration, invasion, and restrained PI3K/AKT/mTOR signaling pathway by targeting VEGFA in vitro. This inhibitory effect of miR-150-5p could be reversed by overexpressing the gene of vascular epithelial growth factor A (VEGFA). In contrary, inhibition of miR-150-5p significantly enhanced migration, invasion ability of both HTR-8/SVneo and JAR cells, and also could stimulate PI3K/AKT/mTOR signaling pathway. This promoting effect of miR-150-5p could be ameliorated by LY294002 (PI3K inhibitor). Finally, after miR-150-5p overexpression in vivo, the embryo resorption rate in pregnant mice was increased significantly.ConclusionsOverall, these findings imply that miR-150-5p is among the key factors that regulate the pathogenesis of URSA.
| S-EPMC10789717 | biostudies-literature
Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.
| S-EPMC9201170 | biostudies-literature
Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.
| S-EPMC10280933 | biostudies-literature
Project description:Human leukocyte antigen-E (HLA-E)is a non-classical major histocompatibility complex (MHC) class I antigens which expressed on extra villous cytotrophoblast, which interacts with NKG2A, is an inhibitory receptor on natural killer (NK) cells and leading to down regulation of immune response in the maternal-fetal interface and provides maternal immune tolerance of the fetus.This study was designated to investigate the gene frequencies of E0101 and E0103 in HLA-E gene in Iranian women with recurrent spontaneous abortion (RSA).Amplification Refractory Mutation System (ARMS-PCR) technique was carried out to detect polymorphism in exon 3 of the HLA-E gene in women with RSA and controls (n=200). Differences between groups were analyzed by SPSS19 software using (2) test.There was no significant difference in the allele frequencies of the HLA-E polymorphism between RSA and fertile controls but HLA-E 0101/0103 heterozygous genotype was found to be significantly higher in RSA group (p=0.006, OR=1.73), so this genotype might confer susceptibility to RSA.Our results suggest that HLA-E 0101/0103 heterozygous genotype leads to increase of RSA risk. It seems that by genotyping of HLA-E polymorphism, we can predict the risk of RSA in infertile women.
| S-EPMC4971558 | biostudies-other
Project description:BACKGROUND:Recurrent Spontaneous Abortion (RSA) is caused by multiple genetic and non-genetic factors. Around 50% of the RSA cases have no known etiology and are considered as Unexplained RSA (URSA). Estrogens, via binding to their receptors, play an important role in female reproduction. This study aimed to investigate whether single nucleotide polymorphisms (SNPs; +1082G/A, +1730G/A and rs1256030 C/T) in the estrogen receptor beta (ESR2) gene are associated with susceptibility to URSA in a population of Iranian women. METHODS:In this case-control study, the study groups consisted of 240 subjects with a history of URSA and 102 fertile women as controls. Serum levels of follicle stimulating hormone (FSH), luteinizing hormone (LH), and estradiol (E2) were measured on day 2-3 of menstrual cycle. Two functional SNPs, +1082G/A (a silent mutation in exon 5) and +1730G/A (3' untranslated region of the exon 8), and one intron, rs1256030C/T, in the ESR2 gene were genotyped, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. RESULTS:Serum levels of LH were significantly increased in URSA women. No significant differences in distribution of +1082G/A, +1730G/A and rs1256030C/T between URSA and control groups were observed. CONCLUSION:Our findings suggest that the studied SNPs on ESR2 gene may not be associated with URSA.
| S-EPMC5501144 | biostudies-literature
Project description:Currently, the precise causes of over 40 % of recurrent spontaneous abortion (RSA) cases cannot be identified, leading to the term "unexplained RSA" (URSA). Through an exploration of the gut microbiota, metabolites, and immune cell subsets in URSA, this study establishes a link between gut microbiota-derived metabolites and immune cells. The results indicate reduced diversity in the gut microbiota of URSA. Targeted metabolomic analyses reveal decreased levels of gut microbiota-derived deoxycholic acid (DCA), glycolithocholic acid (GLCA), acetate, propionate, and butyrate in URSA. Furthermore, elevated frequencies of Th1, Th17, and plasma B cells, along with decreased frequencies of Tregs and Bregs, are observed in the peripheral blood of URSA. The results demonstrate correlations between the levels of gut microbiota-derived bile acids and short-chain fatty acids and the frequencies of various immune cell subsets in circulation. Collectively, this study uncovers an association between gut microbiota-derived metabolites and circulating immune cell subsets in URSA.
| S-EPMC10835175 | biostudies-literature