Novel Compound Heterozygous Variants in TBCD Gene Associated with Infantile Neurodegenerative Encephalopathy.
Ontology highlight
ABSTRACT:
SUBMITTER: Chen CL
PROVIDER: S-EPMC8699832 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:We describe four families with affected siblings showing unique clinical features: early-onset (before 1 year of age) progressive diffuse brain atrophy with regression, postnatal microcephaly, postnatal growth retardation, muscle weakness/atrophy, and respiratory failure. By whole-exome sequencing, we identified biallelic TBCD mutations in eight affected individuals from the four families. TBCD encodes TBCD (tubulin folding co-factor D), which is one of five tubulin-specific chaperones playing a pivotal role in microtubule assembly in all cells. A total of seven mutations were found: five missense mutations, one nonsense, and one splice site mutation resulting in a frameshift. In vitro cell experiments revealed the impaired binding between most mutant TBCD proteins and ARL2, TBCE, and β-tubulin. The in vivo experiments using olfactory projection neurons in Drosophila melanogaster indicated that the TBCD mutations caused loss of function. The wide range of clinical severity seen in this neurodegenerative encephalopathy may result from the residual function of mutant TBCD proteins. Furthermore, the autopsied brain from one deceased individual showed characteristic neurodegenerative findings: cactus and somatic sprout formations in the residual Purkinje cells in the cerebellum, which are also seen in some diseases associated with mitochondrial impairment. Defects of microtubule formation caused by TBCD mutations may underlie the pathomechanism of this neurodegenerative encephalopathy.
| S-EPMC5065661 | biostudies-literature
Project description:Mutation in a growing spectrum of genes is known to either cause or contribute to primary or secondary microcephaly. In primary microcephaly the genetic determinants frequently involve mutations that contribute to or modulate the microtubule cytoskeleton by causing perturbations of neuronal proliferation and migration. Here we describe four patients from two unrelated families each with an infantile neurodegenerative disorder characterized by loss of developmental milestones at 9–24 months of age followed by seizures, dystonia and acquired microcephaly. The patients harboured homozygous missense mutations (A475T and A586V) in TBCD, a gene encoding one of five tubulin-specific chaperones (termed TBCA-E) that function in concert as a nanomachine required for the de novo assembly of the α/β tubulin heterodimer. The latter is the subunit from which microtubule polymers are assembled. We found a reduced intracellular abundance of TBCD in patient fibroblasts to about 10% (in the case of A475T) or 40% (in the case of A586V) compared to age-matched wild type controls. Functional analyses of the mutant proteins revealed a partially compromised ability to participate in the heterodimer assembly pathway. We show via in utero shRNA-mediated suppression that a balanced supply of tbcd is critical for cortical cell proliferation and radial migration in the developing mouse brain. We conclude that TBCD is a novel functional contributor to the mammalian cerebral cortex development, and that the pathological mechanism resulting from the mutations we describe is likely to involve compromised interactions with one or more TBCD-interacting effectors that influence the dynamics and behaviour of the neuronal cytoskeleton.
| S-EPMC6459059 | biostudies-literature
Project description:We report compound heterozygous variants in HTT, the gene encoding huntingtin, in association with an autosomal recessive neurodevelopmental disorder. Three siblings presented with severe global developmental delay since birth, central hypotonia progressing to spastic quadraparesis, feeding difficulties, dystonia (2/3 sibs), prominent midline stereotypies (2/3), bruxism (1/3), high myopia (2/3), and epilepsy (1/3). Whole exome sequencing identified compound heterozygous variants in HTT that co-segregated in the three affected sibs and were absent in an unaffected sib. There were no additional variants in other genes that could account for the reported phenotype. Molecular analysis of HTT should be considered, not just for Huntington's disease, but also in children with a Rett-like syndrome who test negative for known Rett and Rett-like syndrome genes.
| S-EPMC5117927 | biostudies-literature
Project description:PurposeThe gene encoding nicotinamide nucleotide adenylyltransferase 1 (NMNAT1) was recently found to be mutated in a subset of patients with Leber congenital amaurosis (LCA) with macular atrophy. The aim of this study was to determine the occurrence and frequency of NMNAT1 mutations and associated phenotypes in different types of inherited retinal dystrophies.MethodsDNA samples of 161 patients with LCA without genetic diagnosis were analyzed for variants in NMNAT1 using Sanger sequencing. Variants in exon 5 of NMNAT1, which harbors the majority of the previously identified mutations, were screened in 532 additional patients with retinal dystrophies. This cohort encompassed 108 persons with isolated or autosomal recessive cone-rod dystrophy (CRD), 271 with isolated or autosomal recessive retinitis pigmentosa (RP), and 49 with autosomal dominant RP, as well as 104 persons with LCA in whom the causative mutation was previously identified.ResultsCompound heterozygous alterations were found in six patients with LCA and in one person with early-onset RP. All except one carried the common p.E257K variant on one allele. Macular atrophy was absent in one patient, who carried this variant in combination with a truncating mutation on the other allele. The p.E257K alteration was also found in a heterozygous state in five individuals with LCA and one with RP while no mutation was detected on the other allele. Two individuals with LCA carried other NMNAT1 variants in a heterozygous state, whereas no NMNAT1 variants in exon 5 were identified in individuals with CRD. The p.E257K variant was found to be enriched in a heterozygous state in individuals with LCA (0.94%) compared to Caucasian controls (0.18%), although the difference was statistically insignificant (p=0.12).ConclusionsAlthough macular atrophy can occur in LCA and CRD, no NMNAT1 mutations were found in the latter cohort. NMNAT1 variants were also not found in a large group of patients with sporadic or autosomal recessive RP. The enrichment of p.E257K in a heterozygous state in patients with LCA versus controls suggests that this allele could act as a modifier in other genetic subtypes of LCA.
| S-EPMC4043607 | biostudies-literature
Project description:Ethylmalonic encephalopathy (EE) is a very rare autosomal recessive metabolic disorder that primarily affects children. Less than one hundred EE patients have been diagnosed worldwide. The clinical manifestations include chronic diarrhea, petechiae, orthostatic acrocyanosis, psychomotor delay and regression, seizures, and hypotonia. The ETHE1 gene has been shown to be associated with EE, and genetic sequencing provides concrete evidence for diagnosis. To date, only 37 variants of ETHE1 have been reported as disease-causing in EE patients. We identified two novel ETHE1 variants, i.e., c.595+1G>T at the canonical splice site and the missense variant c.586G>C (p. D196H), in a 3-year-old Chinese boy with EE. The patient had mild symptoms with only chronic diarrhea. The typical symptoms, including spontaneous petechiae, acrocyanosis, and hypotonia, were all absent. Herein, we report on the clinical, biochemical, and genetic findings of our patient and review the phenotypes and genotypes of all patients with EE caused by ETHE1 variants with available information. This study supports the early assessment and diagnosis of EE.
| S-EPMC7181787 | biostudies-literature
Project description:BackgroundEnterokinase deficiency (EKD) is a rare autosomal recessively inherited disorder mainly characterized by diarrhea, hypoproteinemia and failure to thrive in infancy. Loss-of-function variants in the TMPRSS15 gene cause EKD.MethodsWe report the clinical manifestations and molecular basis of EKD in a Chinese child. We investigated in vitro two TMPRSS15 variants: the c.1921G > A as a possible splicing variant by minigene assay; the c.2396T > A(p.Val799Asp) as a missense change by protein expression analysis, enterokinase activity and effect on cellular localization.ResultsThe proband presented with intractable diarrhea accompanied by vomiting, failure to thrive and hypoproteinemia in his second year. Genetic analysis showed that the patient was compound heterozygous for two variants in the TMPRSS15 gene: c.[1921G > A];[2396T > A]. The c.1921 G > A variant may change the glutamic acid 641 into lysine; this change is predicted to be benign by bioinformatics analysis. However, it was predicted to disrupt the splicing donor site. Our minigene assay revealed that c.1921G > A caused the skipping of exon 16. The c.2396T > A(p.Val799Asp) change in the serine protease domain predicted to be deleterious hitting an evolutionary conserved amino acid. Functional studies in vitro revealed that the p.Val799Asp variant decreased the total expression level of TMPRSS15 by 29%, and the enterokinase activity of p.Val799Asp mutants was decreased by 37%, compared with that of wild type.ConclusionWe reported an EKD patient with novel compound heterozygous variants in the TMPRSS15 gene, expanding the genotypic and phenotypic spectrum of EKD. The functional characterization in vitro demonstrated that the c.1921G > A variant alters pre-mRNA splicing and the p.Val799Asp variant leads to a decrease in protein expression and enzyme activity.
| S-EPMC7517701 | biostudies-literature
Project description:Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.
| S-EPMC7308501 | biostudies-literature
Project description:Our study reports the case of a patient with early onset of epileptic encephalopathy harboring compound heterozygous Szt2 variants. We provide the first evidence that these Szt2 variants impair mitochondrial energy metabolism. Our results shed light on their pathogenic molecular mechanism and clinical implications for brain development and disease progression.
| S-EPMC6293145 | biostudies-literature
Project description:Lipopolysaccharide-responsive beige-like anchor (LRBA) deficiency is a subtype of common variable immune deficiency (CVID). Numerous case reports and cohort studies have described a broad spectrum of clinical manifestations and variable disease phenotypes, including immune dysregulation, enteropathy, and recurrent infections. Although LRBA deficiency is an autosomal recessive primary immunodeficiency resulting in a phenotype similar to CVID, it is a monogenic disease and separate from CVID. Recently, in a report of monogenic primary immunodeficiency disorder associated with CVID and autoimmunity, the most common mutated gene was LRBA. We report the case of a girl who presented with fulminant type 1 diabetes at age 7 months. She later experienced recurrent bacterial infections with neutropenia and idiopathic thrombocytopenic purpura. Clinical genome sequencing revealed compound heterozygosity of the LRBA gene, which bore two novel mutations. A genetic basis should be considered in the differential diagnosis for very young patients with fulminant autoimmunity, and the diagnostic work-up should include evaluation of markers of immunodeficiency.
| S-EPMC8072023 | biostudies-literature
Project description:CACNA2D2 encodes an auxiliary subunit of the voltage-dependent calcium channel. To date, there have only been two reports of individuals with early-infantile epileptic encephalopathy due to CACNA2D2 mutations. In both reports, patients were homozygous for the identified variants. Here, we report a patient with epileptic encephalopathy and cerebellar atrophy who was found to have two novel variants in the CACNA2D2 gene: c.782C>T (p.Pro261Leu) and c.3137T>C (p.Leu1046Pro), by whole-exome sequencing. The variants were shown to be inherited in trans and the unaffected parents were confirmed to be heterozygous carriers. This is the third report of recessive CACNA2D2 variants associated with disease and the first report of compound heterozygous variants. The clinical description of this new case highlights the phenotypic similarities amongst individuals with CACNA2D2-related disease and suggests that CACNA2D2 should be considered as a differential diagnosis in individuals with cerebellar dysfunction and multiple seizure types that begin in the first year of life.
| S-EPMC6205307 | biostudies-literature