Unknown

Dataset Information

0

Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia.

ABSTRACT: Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50?) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

SUBMITTER: Zhang L 

PROVIDER: S-EPMC7308501 | biostudies-literature | 2020

REPOSITORIES: biostudies-literature

Json Xml
altmetric image

Publications

Compound Heterozygous <i>PIGS</i> Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia.

Zhang Lily L   Mao Xiao X   Long Hongyu H   Xiao Bo B   Luo Zhaohui Z   Xiao Wenbiao W   Jin Xingbing X  

Frontiers in genetics 20200616

Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disab  ...[more]

Similar Datasets

Unknown Novel, compound heterozygous, single-nucleotide variants in MARS2 associated with developmental delay, poor growth, and sensorineural hearing loss.
| S-EPMC4439286 | biostudies-literature
Unknown Variants in DOCK3 cause developmental delay and hypotonia.
| S-EPMC6777627 | biostudies-literature
Unknown De Novo Heterozygous POLR2A Variants Cause a Neurodevelopmental Syndrome with Profound Infantile-Onset Hypotonia.
| S-EPMC6699192 | biostudies-literature
Unknown A patient with lissencephaly, developmental delay, and infantile spasms, due to de novo heterozygous mutation of <i>KIF2A</i>.
| S-EPMC5118204 | biostudies-literature
Unknown De novo mutations in PURA are associated with hypotonia and developmental delay.
| S-EPMC4850890 | biostudies-literature
Unknown Exome sequencing reveled a compound heterozygous mutations in <i>RTTN</i> gene causing developmental delay and primary microcephaly.
| S-EPMC8116967 | biostudies-literature
Unknown Diagnosis of Schaaf-Yang syndrome in Korean children with developmental delay and hypotonia.
| S-EPMC7748310 | biostudies-literature
Unknown Novel compound heterozygous mutations in <i>WDR62</i> gene leading to developmental delay and Primary Microcephaly in Saudi Family.
| S-EPMC6572970 | biostudies-literature
Proteomics De novo heterozygous variants in POLR2A cause a neurodevelopmental syndrome with infantile-onset hypotonia
2019-09-02 | PXD011355 | Pride
Unknown Novel Compound Heterozygous Variants in TBCD Gene Associated with Infantile Neurodegenerative Encephalopathy.
| S-EPMC8699832 | biostudies-literature