Browse
Submit Data
Databases
API
Help

Dataset Information

30 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA purification-free detection of SARS-CoV-2 using reverse transcription loop-mediated isothermal amplification (RT-LAMP).

ABSTRACT:

Background

Current diagnosis of SARS-CoV-2 infection relies on RNA purification prior to amplification. Typical extraction methods limit the processing speed and turnaround time for SARS-CoV-2 diagnostic testing.

Methods

Here, we applied reverse transcription loop-mediated isothermal amplification directly onto human clinical swabs samples to amplify the RNA from SARS-CoV-2 swab samples after processing with chelating resin.

Results

By testing our method on 64 samples, we managed to develop an RT-LAMP assay with 95.9% sensitivity (95% CI 86 to 99.5%) and 100% specificity (95% CI 78.2-100%).

Conclusion

The entire process including sample processing can be completed in approximately 50 min. This method has promising potential to be applied as a fast, simple and inexpensive diagnostic tool for the detection of SARS-CoV-2.

SUBMITTER: Lai MY

PROVIDER: S-EPMC8723997 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Clinical testing on SARS-CoV-2 swab samples using reverse-transcription loop-mediated isothermal amplification (RT-LAMP).

Project description:BackgroundHigh cost of commercial RNA extraction kits limits the testing efficiency of SARS-CoV-2. Here, we developed a simple nucleic acid extraction method for the detection of SARS-CoV-2 directly from nasopharyngeal swab samples.MethodsA pH sensitive dye was used as the end point detection method. The obvious colour changes between positive and negative reactions eliminates the need of other equipment.ResultsClinical testing using 260 samples showed 92.7% sensitivity (95% CI 87.3-96.3%) and 93.6% specificity (95% CI 87.3-97.4%) of RT-LAMP.ConclusionsThe simple RNA extraction method minimizes the need for any extensive laboratory set-up. We suggest combining this simple nucleic acid extraction method and RT-LAMP technology as the point-of care diagnostic tool.

| S-EPMC9387413 | biostudies-literature

One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV.

Project description:Due to the limitation of rapid development of specific antiviral drug or vaccine for novel emerging viruses, an accurate and rapid diagnosis is a key to manage the virus spread. We developed an efficient and rapid method with high specificity for the Middle East Respiratory Syndrome coronavirus (MERS-CoV), based on one-pot reverse transcription loop-mediated isothermal amplification (one-pot RT-LAMP). A set of six LAMP primers [F3, B3, FIP, BIP, LF (Loop-F), and LB (Loop-B)] were designed using the sequence of nucleocapsid (N) gene with optimized RT-LAMP enzyme conditions: 100 U M-MLV RTase and 4 U Bst polymerase, implying that the reaction was able to detect four infectious viral genome copies of MERS-CoV within a 60 min reaction time period. Significantly, EvaGreen dye has better signal read-out properties in one-pot RT-LAMP reaction and is more compatible with DNA polymerase than SYBR green I. Isothermally amplified specific N genes were further evaluated using field-deployable microchamber devices, leading to the specific identification of as few as 0.4 infectious viral genome copies, with no cross-reaction to the other acute respiratory disease viruses, including influenza type A (H1N1 and H3N2), type B, human coronavirus 229E, and human metapneumovirus. This sensitive, specific and feasible method provides a large-scale technical support in emergencies, and is also applied as a sample-to-detection module in Point of Care Testing devices.

| S-EPMC5220095 | biostudies-literature

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence.

Project description:BackgroundThe COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC).ResultThe results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500-5,000, 6,500-7,500, and 23,300-25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests.ConclusionThis study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.

| S-EPMC10728416 | biostudies-literature

Colorimetric and fluorometric reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for diagnosis of SARS-CoV-2.

Project description:The coronavirus disease 2019 (COVID-19) caused by the severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) has caused millions of infections and deaths worldwide since it infected humans almost 3 years ago. Improvements of current assays and the development of new rapid tests or to diagnose SARS-CoV-2 are urgent. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) is a rapid and propitious assay, allowing to detect both colorimetric and/or fluorometric nucleic acid amplifications. This study describes the analytical and clinical evaluation of RT-LAMP assay for detection of SARS-CoV-2, by designing LAMP primers targeting N (nucleocapsid phosphoprotein), RdRp (polyprotein), S (surface glycoprotein), and E (envelope protein) genes. The assay's performance was compared with the gold standard RT-PCR, yielding 94.6% sensitivity and 92.9% specificity. Among the tested primer sets, the ones for S and N genes had the highest analytical sensitivity, showing results in about 20 min. The colorimetric and fluorometric comparisons revealed that the latter is faster than the former. The limit of detection (LoD) of RT-LAMP reaction in both assays is 50 copies/µl of the reaction mixture. However, the simple eye-observation advantage of the colorimetric assay (with a color change from yellow to red) serves a promising on-site point-of-care testing method anywhere, including, for instance, laboratory and in-house applications.

| S-EPMC9464610 | biostudies-literature

Rapid point-of-care detection of SARS-CoV-2 using reverse transcription loop-mediated isothermal amplification (RT-LAMP).

Project description:BackgroundFast, reliable and easy to handle methods are required to facilitate urgently needed point-of-care testing (POCT) in the current coronavirus pandemic. Life-threatening severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has rapidly spread all over the world, infecting more than 33,500,000 people and killing over 1 million of them as of October 2020. Infected individuals without any symptoms might still transfer the virus to others underlining the extraordinary transmissibility of this new coronavirus. In order to identify early infections effectively, treat patients on time and control disease spreading, rapid, accurate and onsite testing methods are urgently required.ResultsHere we report the development of a loop-mediated isothermal amplification (LAMP) based method to detect SARS-CoV-2 genes ORF8 and N directly from pharyngeal swab samples. The established reverse transcription LAMP (RT-LAMP) assay detects SARS-CoV-2 directly from pharyngeal swab samples without previous time-consuming and laborious RNA extraction. The assay is sensitive and highly specific for SARS-CoV-2 detection, showing no cross reactivity when tested on 20 other respiratory pathogens. The assay is 12 times faster and 10 times cheaper than routine reverse transcription real-time polymerase chain reaction, depending on the assay used.ConclusionThe fast and easy to handle RT-LAMP assay amplifying specifically the genomic regions ORF8 and N of SARS-CoV-2 is ideally suited for POCT at e.g. railway stations, airports or hospitals. Given the current pandemic situation, rapid, cost efficient and onsite methods like the here presented RT-LAMP assay are urgently needed to contain the viral spread.

| S-EPMC7576985 | biostudies-literature

A semi-automated, isolation-free, high-throughput SARS-CoV-2 reverse transcriptase (RT) loop-mediated isothermal amplification (LAMP) test.

Project description:Shortages of reverse transcriptase (RT)-polymerase chain reaction (PCR) reagents and related equipment during the COVID-19 pandemic have demonstrated the need for alternative, high-throughput methods for severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2)-mass screening in clinical diagnostic laboratories. A robust, SARS-CoV-2 RT-loop-mediated isothermal amplification (RT-LAMP) assay with high-throughput and short turnaround times in a clinical laboratory setting was established and compared to two conventional RT-PCR protocols using 323 samples of individuals with suspected SARS-CoV-2 infection. Limit of detection (LoD) and reproducibility of the isolation-free SARS-CoV-2 RT-LAMP test were determined. An almost perfect agreement (Cohen's kappa > 0.8) between the novel test and two classical RT-PCR protocols with no systematic difference (McNemar's test, P > 0.05) was observed. Sensitivity and specificity were in the range of 89.5 to 100% and 96.2 to 100% dependent on the reaction condition and the RT-PCR method used as reference. The isolation-free RT-LAMP assay showed high reproducibility (Tt intra-run coefficient of variation [CV] = 0.4%, Tt inter-run CV = 2.1%) with a LoD of 95 SARS-CoV-2 genome copies per reaction. The established SARS-CoV-2 RT-LAMP assay is a flexible and efficient alternative to conventional RT-PCR protocols, suitable for SARS-CoV-2 mass screening using existing laboratory infrastructure in clinical diagnostic laboratories.

| S-EPMC8560768 | biostudies-literature

Detection of Novel duck reovirus (NDRV) using visual reverse transcription loop-mediated isothermal amplification (RT-LAMP).

Project description:Here we present a visual reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for detecting the gene encoding the ?B major outer-capsid protein of novel duck reovirus (NDRV). A set of primers, composed of two outer primers, two inner primers and two loop primers, was designed based on the gene of interest. The LAMP reaction was conducted in a traditional laboratory water bath at 65?°C for 50?min. We compared the performance of calcein/Mn2+ and SYBR Green I dyes, as well as electrophoresis on agarose gel stained with GoldView nucleic acid dye to detect the RT-LAMP-amplified products and all assays could be employed to discriminate between positive and negative specimens in visible or UV light. Our data showed that there is no cross-reaction with other viruses and the RT-LAMP technique displayed high sensitivity for detecting NDRV with a minimal detection limit of 200 fg RNA input. This assay was more sensitive than conventional PCR in detecting NDRV both in natural and experimental infection. In conclusion, the RT-LAMP technique was remarkably sensitive, specific, rapid, simple and profitable for the identification of NDRV.

| S-EPMC6145877 | biostudies-literature

One-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) for detection of tomato torrado virus.

Project description:'Torrado' disease caused by tomato torrado virus (ToTV) is responsible for considerable losses in tomato production. Therefore, a one-step reverse transcription loop-mediated isothermal amplification protocol for early and fast detection of ToTV isolates has been developed. The RNA extracted from ToTV-infected plants was tested using this protocol with a set of six primers specific for the Vp35 coat protein gene sequence. The amplified products were analyzed using amplification curves, electrophoresis, and direct staining of DNA. The sensitivity of the protocol was tenfold higher than that of conventional RT-PCR. This new protocol is inexpensive, rapid, simple, and very sensitive.

| S-EPMC4839060 | biostudies-literature

Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP).

Project description:BackgroundThe first documented case of Middle East Respiratory Syndrome coronavirus (MERS-CoV) occurred in 2012, and outbreaks have continued ever since, mainly in Saudi Arabia. MERS-CoV is primarily diagnosed using a real-time RT-PCR assay, with at least two different genomic targets required for a positive diagnosis according to the case definition of The World Health Organization (WHO) as of 3 July 2013. Therefore, it is urgently necessary to develop as many specific genetic diagnostic methods as possible to allow stable diagnosis of MERS-CoV infections.MethodsReverse transcription-loop-mediated isothermal amplification (RT-LAMP) is a genetic diagnostic method used widely for the detection of viral pathogens, which requires only a single temperature for amplification, and can be completed in less than 1 h. This study developed a novel RT-LAMP assay for detecting MERS-CoV using primer sets targeting a conserved nucleocapsid protein region.ResultsThe RT-LAMP assay was capable of detecting as few as 3.4 copies of MERS-CoV RNA, and was highly specific, with no cross-reaction to other respiratory viruses. Pilot experiments to detect MERS-CoV from medium containing pharyngeal swabs inoculated with pre-titrated viruses were also performed. The RT-LAMP assay exhibited sensitivity similar to that of MERS-CoV real-time RT-PCR.ConclusionsThese results suggest that the RT-LAMP assay described here is a useful tool for the diagnosis and epidemiologic surveillance of human MERS-CoV infections.

| S-EPMC4132226 | biostudies-literature

Rapid detection of Akabane virus by a novel reverse transcription loop-mediated isothermal amplification assay (RT-LAMP).

Project description:BACKGROUND: Akabane disease, caused by Akabane virus, is an insect-transmitted disease of ruminants that is primarily characterized by fetal damage. METHODS AND RESULTS: In this study, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for rapid detection of Akabane virus was successfully developed. The primers were designed to target the highly conserved fragment of nucleoprotein from the Akabane virus. The results indicate that the assay is highly specific and sensitive with a detection limit of 5.0 TCID50/mL within a 60-min incubation time. A total of 126 abortive samples collected from Xinjiang province were detected by the established RT-LAMP. The results of RT-LAMP assay showed 96.8% agreement with the semi-nested RT-PCR. CONCLUSION: This study is to first to develop a rapid, sensitive, and accurate method for the detection of Akabane virus, which may be used to screen clinical samples in developing countries or regions.

| S-EPMC3848447 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data