Detection and imaging of Hg(II) in vivo using glutathione-functionalized gold nanoparticles.
Ontology highlight
ABSTRACT:
SUBMITTER: Li G
PROVIDER: S-EPMC9235832 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:Begomoviruses are a major class of Geminiviruses that affects most dicotyledonous plants and causes heavy economic losses to farmers. Early detection of begomovirus is essential to control the spread of the disease and prevent loss. Many available detection methods like ELISA, immunosorbent electron microscopy, PCR or qPCR require expertise in handling sophisticated instruments, complex data interpretation and costlier chemicals, enzymes or antibodies. Hence there is a need for a simpler detection method, here we report the development of a visual detection method based on functionalized gold nanoparticles (AuNP assay). The assay was able to detect up to 500 ag/µl of begomoviral DNA (pTZCCPp3, a clone carrying partial coat protein gene) suspended in MilliQ water. Screening of chilli plants for begomoviral infection by PCR (Deng primers) and AuNP assay showed that AuNP assay (77.7%) was better than PCR (49.4%). The AuNP assay with clccpi1 probe was able to detect begomoviral infection in chilli, tomato, common bean, green gram and black gram plants which proved the utility and versatility of the AuNP assay. The specificity of the assay was demonstrated by testing with total DNA from different plants that are not affected by begomoviruses.
| S-EPMC8271019 | biostudies-literature
Project description:Gold nanoparticles functionalized with resorcinol moieties have been prepared and used for detecting formaldehyde both in solution and gas phases. The detection mechanism is based on the color change of the probe upon the aggregation of the nanoparticles induced by the polymerization of the resorcinol moieties in the presence of formaldehyde. A limit of detection of 0.5 ppm in solution has been determined. The probe can be deployed for the detection of formaldehyde emissions from composite wood boards.
| S-EPMC6409679 | biostudies-literature
Project description:We report a sensitive method for visual detection of mercury ions (II) (Hg²⁺) in aqueous solution by using gold nanoparticles (Au-NPs) and thymine (T)-rich hairpin DNA probes. The thiolated hairpin DNA probe was immobilized on the Au-NP surface through a self-assembling method. Another thymine-rich, digoxin-labeled DNA probe was introduced to form DNA duplexes on the Au-NP surface with thymine-Hg²⁺-thymine (T-Hg²⁺-T) coordination in the presence of Hg²⁺. The Au-NPs associated with the formed duplexes were captured on the test zone of a lateral flow strip biocomponent (LFSB) by immunoreaction events between the digoxin on the duplexes and anti-digoxin antibodies on the LFSB. The accumulation of Au-NPs produced a characteristic red band on the test zone, enabling visual detection of Hg²⁺ without instrumentation. A detection limit of 0.1 nM was obtained under optimal experimental conditions. This method provides a simple, rapid, sensitive approach for the detection of Hg²⁺ and shows great promise for point-of-care and in-field detection of environmentally toxic mercury.
| S-EPMC3220944 | biostudies-literature
Project description:A rapid detection test for SARS-CoV-2 is urgently required to monitor virus spread and containment. Here, we describe a test that uses nanoprobes, which are gold nanoparticles functionalized with an aptamer specific to the spike membrane protein of SARS-CoV-2. An enzyme-linked immunosorbent assay confirms aptamer binding with the spike protein on gold surfaces. Protein recognition occurs by adding a coagulant, where nanoprobes with no bound protein agglomerate while those with sufficient bound protein do not. Using plasmon absorbance spectra, the nanoprobes detect 16 nM and higher concentrations of spike protein in phosphate-buffered saline. The time-varying light absorbance is examined at 540 nm to determine the critical coagulant concentration required to agglomerates the nanoprobes, which depends on the protein concentration. This approach detects 3540 genome copies/μl of inactivated SARS-CoV-2.
| S-EPMC8409056 | biostudies-literature
Project description:A simple green route has been developed for the synthesis of casein peptide functionalized gold nanoparticles (AuNPs), in which casein peptide acts as a reducing as well as the stabilizing agent. In this report, AuNPs have been characterized on the basis of spectroscopic and microscopic results; which showed selective and sensitive response toward Al3+ in aqueous media, and Al3+ induces aggregation of AuNPs. The sensing study performed for Al3+ revealed that the color change from red to blue was due to a red-shift in the surface plasmon resonance (SPR) band and the formation of aggregated species of AuNPs. The calibration curve determines the detection limit (LOD) for Al3+ about 20 ppb (0.067 μM) is presented using both decrease and increase in absorbance at 530 and 700 nm, respectively. This value is considerably lower than the higher limit allowed for Al3+ in drinking water by the world health organization (WHO) (7.41 μM), representing enough sensitivity to protect water quality. The intensity of the red-shifted band increases with linear pattern upon the interaction with different concentrations of Al3+, thus the possibility of producing unstable AuNPs aggregates. The method is successfully used for the detection of Al3+ in water samples collected from various sources, human urine and ionic drink. The actual response time required for AuNPs is about 1 min, this probe also have several advantages, such as ease of synthesis, functionalization and its use, high sensitivity, and enabling on-site monitoring.
| S-EPMC5666452 | biostudies-literature
Project description:Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.
| S-EPMC2867084 | biostudies-literature
Project description:This study was designed to evaluate the nano-bio interactions between endogenous biothiols (cysteine and glutathione) with biomedically relevant, metallic nanoparticles (silver nanoparticles (AgNPs) and gold nanoparticles (AuNPs)), in order to assess the biocompatibility and fate of nanoparticles in biological systems. A systematic and comprehensive analysis revealed that the preparation of AgNPs and AuNPs in the presence of biothiols leads to nanoparticles stabilized with oxidized forms of biothiols. Their safety was tested by evaluation of cell viability, reactive oxygen species (ROS) production, apoptosis induction and DNA damage in murine fibroblast cells (L929), while ecotoxicity was tested using the aquatic model organism Daphnia magna. The toxicity of these nanoparticles was considerably lower compared to their ionic metal forms (i.e., Ag+ and Au3+). The comparison with data published on polymer-coated nanoparticles evidenced that surface modification with biothiols made them safer for the biological environment. In vitro evaluation on human cells demonstrated that the toxicity of AgNPs and AuNPs prepared in the presence of cysteine was similar to the polymer-based nanoparticles with the same core material, while the use of glutathione for nanoparticle stabilization was considerably less toxic. These results represent a significant contribution to understanding the role of biothiols on the fate and behavior of metal-based nanomaterials.
| S-EPMC6753685 | biostudies-literature
Project description:A novel luminescent turn-on detection method for Hg(II) was developed. The method was based on the silver nanoparticle (AgNP)-mediated quenching of Ir(III) complex 1. The addition of Hg(II) ions causes the luminescence of complex 1 to be recovered due to the oxidation of AgNPs by Hg(II) ions to form Ag(I) and Ag/Hg amalgam. The luminescence intensity of 1 increased in accord with an increased Hg(II) concentration ranging from 0?nM to 180?nM, with the detection limit of 5?nM. This approach offers an innovative method for the quantification of Hg(II).
| S-EPMC5472617 | biostudies-literature
Project description:The development of quick and efficient methods for the detection of pathogenic bacteria is urgently needed for the diagnosis of infectious diseases and the control of microbiological contamination in global waterways, potable water sources and the food industry. This contribution will describe the synthesis of gold nanoparticles and their conjugation to broad spectrum, polypeptide and β-lactam antibiotics that function as both reducing agents and surface protectants (ATB@AuNP). Nanoparticle colloids examined using transmission electron microscopy are generally spherical in shape and range from 2-50 nm in size. Dynamic light scattering and infrared spectroscopy were also used to confirm encapsulation of the AuNP surface by antibiotic molecules. ATB@AuNP were then used to detect 3 common pathogenic bacterial species: Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. The colour of the AuNP colloid was monitored visually and using UV-visible spectroscopy. A red shift of the UV visible absorbance and a visible colour change following introduction of each pathogen is indicative of ATB binding to the bacteria surface, ascribed to AuNP agglomeration. This work demonstrates that ATB@AuNP may be an efficient and high throughput tool for the rapid detection of common bacterial contaminants.
| S-EPMC8697705 | biostudies-literature
Project description:Antimicrobial resistance (AMR) continues to threaten the effective treatment and prevention of bacterial infections. The spread of resistant infections is accelerated by the lack of fast and cost-effective tests for the detection of AMR at the point-of-care. We aimed to address this challenge by developing a diagnostic tool to detect one of the major forms of AMR, the β-lactamase enzymes. Antibiotic-functionalized gold nanoparticles (AuNPs) have been successfully developed for the detection of β-lactamases in challenging biological media, namely undiluted urine. Furthermore, these tools are compatible with samples containing a urine sample preservative (boric acid) or hematuria (blood). The functionalized AuNPs interact with the active β-lactamases, resulting in the hydrolysis of the surface-bound antibiotics, which then inhibits binding of the AuNPs to a capture protein (a penicillin-binding protein) to indicate the presence of active β-lactamases. We successfully integrated the antibiotic-functionalized AuNPs into a new lateral flow assay (LFA), which can be used to detect active β-lactamases down to the detection limit of 11 nM. While we demonstrate the use of antibiotic-functionalized AuNPs in an LFA format to provide a novel method of detecting active β-lactamases, these functionalized AuNPs are amenable to a range of alternative diagnostic technologies and could lead to vital point-of-care diagnostics for the early detection of multi-drug resistant infections.
| S-EPMC9419081 | biostudies-literature