Unknown

Dataset Information

0

Viral detection using DNA functionalized gold filaments.


ABSTRACT: Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.

SUBMITTER: Perez JW 

PROVIDER: S-EPMC2867084 | biostudies-literature | 2009 Aug

REPOSITORIES: biostudies-literature

altmetric image

Publications

Viral detection using DNA functionalized gold filaments.

Perez Jonas W JW   Haselton Frederick R FR   Wright David W DW  

The Analyst 20090515 8


Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify proce  ...[more]

Similar Datasets

| S-EPMC7014198 | biostudies-literature
| S-EPMC8271019 | biostudies-literature
| S-EPMC8974806 | biostudies-literature
| S-EPMC9235832 | biostudies-literature
| S-EPMC6409679 | biostudies-literature
| S-EPMC10898432 | biostudies-literature
2025-10-15 | PXD061096 | Pride