Dataset Information

Viral detection using DNA functionalized gold filaments.

ABSTRACT: Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.

SUBMITTER: Perez JW

PROVIDER: S-EPMC2867084 | biostudies-literature | 2009 Aug

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Viral detection using DNA functionalized gold filaments.

Perez Jonas W JW Haselton Frederick R FR Wright David W DW

The Analyst 20090515 8

Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify proce ...[more]

PMID: 20448919

Similar Datasets

Project description:Acute hepatopancreatic necrosis disease (AHPND) is a component cause of early mortality syndrome (EMS) of shrimp. In 2013, the causative agent was found to be unique isolates of Vibrio parahaemolyticus (VPAHPND) that contained a 69 kbp plasmid (pAP1) carrying binary Pir-like toxin genes PirvpA and PirvpB. In Thailand, AHPND was first recognized in 2012, prior to knowledge of the causative agent, and it subsequently led to a precipitous drop in shrimp production. After VPAHPND was characterized, a major focus of the AHPND control strategy was to monitor broodstock shrimp and post larvae for freedom from VPAHPND by nucleic acid amplification methods, most of which required use of expensive and sophisticated equipment not readily available in a shrimp farm setting. Here, we describe a simpler but equally sensitive approach for detection of VPAHPND based on loop-mediated isothermal amplification (LAMP) combined with unaided visual reading of positive amplification products using a DNA-functionalized, ssDNA-labled nanogold probe (AuNP). The target for the special set of six LAMP primers used was the VPAHPND PirvpA gene. The LAMP reaction was carried out at 65°C for 45 min followed by addition of the red AuNP solution and further incubation at 65°C for 5 min, allowing any PirvpA gene amplicons present to hybridize with the probe. Hybridization protected the AuNP against aggregation, so that the solution color remained red upon subsequent salt addition (positive test result) while unprotected AuNP aggregated and underwent a color change from red to blue and eventually precipitated (negative result). The total assay time was approximately 50 min. The detection limit (100 CFU) was comparable to that of other commonly-used methods for nested PCR detection of VPAHPND and 100-times more sensitive than 1-step PCR detection methods (104 CFU) that used amplicon detection by electrophoresis or spectrophotometry. There was no cross reaction with DNA templates derived from non-AHPND bacteria commonly found in shrimp ponds (including other Vibrio species). The new method significantly reduced the time, difficulty and cost for molecular detection of VPAHPND in shrimp hatchery and farm settings.

Dataset Information

Viral detection using DNA functionalized gold filaments.

Publications

Viral detection using DNA functionalized gold filaments.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets