Browse
Submit Data
Databases
API
Help

Dataset Information

20 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Direct Evidence of Subsurface Oxygen Formation in Oxide-Derived Cu by X-ray Photoelectron Spectroscopy.

ABSTRACT: Subsurface oxygen has been proposed to be crucial in oxide-derived copper (OD-Cu) electrocatalysts for enhancing the binding of CO intermediates during CO₂ reduction reaction (CO₂ RR). However, the presence of such oxygen species under reductive conditions still remains debated. In this work, the existence of subsurface oxygen is validated by grazing incident hard X-ray photoelectron spectroscopy, where OD-Cu was prepared by reduction of Cu oxide with H₂ without exposing to air. The results suggest two types of subsurface oxygen embedded between the fully reduced metallic surface and the Cu₂ O buried beneath: (i) oxygen staying at lattice defects and/or vacancies in the surface-most region and (ii) interstitial oxygen intercalated in metal structure. This study adds convincing support to the presence of subsurface oxygen in OD-Cu, which previously has been suggested to play an important role to mitigate the σ-repulsion of Cu for CO intermediates in CO₂ RR.

SUBMITTER: Wang HY

PROVIDER: S-EPMC9299841 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Using "Tender" X-ray Ambient Pressure X-Ray Photoelectron Spectroscopy as A Direct Probe of Solid-Liquid Interface.

Project description:We report a new method to probe the solid-liquid interface through the use of a thin liquid layer on a solid surface. An ambient pressure XPS (AP-XPS) endstation that is capable of detecting high kinetic energy photoelectrons (7?keV) at a pressure up to 110?Torr has been constructed and commissioned. Additionally, we have deployed a "dip &pull" method to create a stable nanometers-thick aqueous electrolyte on platinum working electrode surface. Combining the newly constructed AP-XPS system, "dip &pull" approach, with a "tender" X-ray synchrotron source (2?keV-7?keV), we are able to access the interface between liquid and solid dense phases with photoelectrons and directly probe important phenomena occurring at the narrow solid-liquid interface region in an electrochemical system. Using this approach, we have performed electrochemical oxidation of the Pt electrode at an oxygen evolution reaction (OER) potential. Under this potential, we observe the formation of both Pt(2+) and Pt(4+) interfacial species on the Pt working electrode in situ. We believe this thin-film approach and the use of "tender" AP-XPS highlighted in this study is an innovative new approach to probe this key solid-liquid interface region of electrochemistry.

| S-EPMC4650780 | biostudies-literature

Direct Evidence of Dynamic Metal Support Interactions in Co/TiO<sub>2</sub> Catalysts by Near-Ambient Pressure X-ray Photoelectron Spectroscopy.

Project description:The interaction between metal particles and the oxide support, the so-called metal-support interaction, plays a critical role in the performance of heterogenous catalysts. Probing the dynamic evolution of these interactions under reactive gas atmospheres is crucial to comprehending the structure-performance relationship and eventually designing new catalysts with enhanced properties. Cobalt supported on TiO2 (Co/TiO2) is an industrially relevant catalyst applied in Fischer-Tropsch synthesis. Although it is widely acknowledged that Co/TiO2 is restructured during the reaction process, little is known about the impact of the specific gas phase environment at the material's surface. The combination of soft and hard X-ray photoemission spectroscopies are used to investigate in situ Co particles supported on pure and NaBH4-modified TiO2 under H2, O2, and CO2:H2 gas atmospheres. The combination of soft and hard X-ray photoemission methods, which allows for simultaneous probing of the chemical composition of surface and subsurface layers, is one of the study's unique features. It is shown that under H2, cobalt particles are encapsulated below a stoichiometric TiO2 layer. This arrangement is preserved under CO2 hydrogenation conditions (i.e., CO2:H2), but changes rapidly upon exposure to O2. The pretreatment of the TiO2 support with NaBH4 affects the surface mobility and prevents TiO2 spillover onto Co particles.

| S-EPMC10574330 | biostudies-literature

In situ ambient pressure X-ray photoelectron spectroscopy studies of lithium-oxygen redox reactions.

Project description:The lack of fundamental understanding of the oxygen reduction and oxygen evolution in nonaqueous electrolytes significantly hinders the development of rechargeable lithium-air batteries. Here we employ a solid-state Li(4+x)Ti(5)O(12)/LiPON/Li(x)V(2)O(5) cell and examine in situ the chemistry of Li-O(2) reaction products on Li(x)V(2)O(5) as a function of applied voltage under ultra high vacuum (UHV) and at 500 mtorr of oxygen pressure using ambient pressure X-ray photoelectron spectroscopy (APXPS). Under UHV, lithium intercalated into Li(x)V(2)O(5) while molecular oxygen was reduced to form lithium peroxide on Li(x)V(2)O(5) in the presence of oxygen upon discharge. Interestingly, the oxidation of Li(2)O(2) began at much lower overpotentials (~240 mV) than the charge overpotentials of conventional Li-O(2) cells with aprotic electrolytes (~1000 mV). Our study provides the first evidence of reversible lithium peroxide formation and decomposition in situ on an oxide surface using a solid-state cell, and new insights into the reaction mechanism of Li-O(2) chemistry.

| S-EPMC3465812 | biostudies-other

Investigating Cu-Site Doped Cu–Sb–S Nanoparticles Using Photoelectron and Electron Paramagnetic Resonance Spectroscopy

Project description: Not available

| S-EPMC11345821 | biostudies-literature

Valence band behaviour of zirconium oxide, Photoelectron and Auger spectroscopy study.

Project description:In this study X-ray Photoelectron Spectroscopy and Ultraviolet Photoelectron Spectroscopy were combined to investigate the effect of oxygen incorporation on the valence band behaviour of ZrOx. The Auger transitions involving valence bands are found to mimic the self-folded density of state measured using Ultraviolet Photoelectron Spectroscopy. The valence band once constructed in a sub-oxide form, stays at a fixed energy position despite the change in the stoichiometry. This behaviour is found to be useful in setting a reference for X-ray Photoelectron Spectroscopy charge correction. The results of the charged corrected spectra were compared to other methods and found to be in great agreement. Finally, a correlation between the core-level binding energy and the structural property of ZrOx is given.

| S-EPMC6214953 | biostudies-literature

Following excited-state chemical shifts in molecular ultrafast x-ray photoelectron spectroscopy.

Project description:The conversion of photon energy into other energetic forms in molecules is accompanied by charge moving on ultrafast timescales. We directly observe the charge motion at a specific site in an electronically excited molecule using time-resolved x-ray photoelectron spectroscopy (TR-XPS). We extend the concept of static chemical shift from conventional XPS by the excited-state chemical shift (ESCS), which is connected to the charge in the framework of a potential model. This allows us to invert TR-XPS spectra to the dynamic charge at a specific atom. We demonstrate the power of TR-XPS by using sulphur 2p-core-electron-emission probing to study the UV-excited dynamics of 2-thiouracil. The method allows us to discover that a major part of the population relaxes to the molecular ground state within 220-250 fs. In addition, a 250-fs oscillation, visible in the kinetic energy of the TR-XPS, reveals a coherent exchange of population among electronic states.

| S-EPMC8752854 | biostudies-literature

X-ray photoelectron spectroscopy and infrared spectroscopy study of maleimide-activated supports for immobilization of oligodeoxyribonucleotides.

Project description:Surface-tethered nucleic acids are widely applied in solid-phase assays in which complementary strands must be detected against a complex mixture of other sequences. In response to such needs, numerous methods have been developed for immobilizing nucleic acids on solid supports. Often, detailed analysis of associated chemical transformations and of potential side reactions is difficult to obtain. Combined use of planar and high surface area powder supports allows characterization using surface as well as bulk diagnostic techniques. This approach is followed in the present study in which X-ray photoelectron spectroscopy (XPS), transmission infrared spectroscopy (FTIR) and reactivity titrations are used to investigate siliceous supports modified with an aminosilane precursor followed by a maleimide-bearing crosslinker for attachment of nucleic acids. The supports retain maleimide activity for approximately a day when stored under buffer, but deactivation is accelerated under basic conditions or by incomplete conversion of the precursor aminosilane monolayer. Reactions involving the olefinic bond of the imide as well as its carbonyl groups are observed and analyzed. Attachment of sulfhydryl-terminated oligodeoxyribonucleotides is highly site specific, and immobilized strands exhibit excellent hybridization activity. Quantitative use of XPS for label-free determination of DNA coverage based on calibration against reference materials is also described.

| S-EPMC534618 | biostudies-literature

Enhanced wetting of Cu on ZnO by migration of subsurface oxygen vacancies.

Project description:Metal adhesion on metal oxides is strongly controlled by the oxide surface structure and composition, but lack of control over the surface conditions often limits the possibilities to exploit this in opto- and micro-electronics applications and heterogeneous catalysis where nanostructural control is of utmost importance. The Cu/ZnO system is among the most investigated of such systems in model studies, but the presence of subsurface ZnO defects and their important role for adhesion on ZnO have been unappreciated so far. Here we reveal that the surface-directed migration of subsurface defects affects the Cu adhesion on polar ZnO(0001) in the technologically interesting temperature range up to 550?K. This leads to enhanced adhesion and ultimately complete wetting of ZnO(0001) by a Cu overlayer. On the basis of our experimental and computational results we demonstrate a mechanism which implies that defect concentrations in the bulk are an important, and possibly controllable, parameter for the metal-on-oxide growth.

| S-EPMC4660204 | biostudies-literature

Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL.

Project description:The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20?hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

| S-EPMC3485869 | biostudies-literature

Gas Pulse-X-Ray Probe Ambient Pressure Photoelectron Spectroscopy with Submillisecond Time Resolution.

Project description:A setup capable of conducting gas pulse-X-ray probe ambient pressure photoelectron spectroscopy with high time resolution is presented. The setup makes use of a fast valve that creates gas pulses with an internal pressure in the mbar range and a rising edge of few hundreds of microseconds. A gated detector based on a fast camera is synchronized with the valve operation to measure X-ray photoemission spectra with up to 20 μs time resolution. The setup is characterized in several experiments in which the N2 gas is pulsed either into vacuum or a constant flow of another gas. The observed width of the pulse rising edge is 80 μs, and the maximum internal pulse pressure is ∼1 mbar. The CO oxidation reaction over Pt (111) was used to demonstrate the capability of the setup to correlate the gas phase composition with that of the surface during transient supply of CO gas into an O2 stream. Thus, formation of both chemisorbed and oxide oxygen species was observed prior to CO gas perturbation. Also, the data indicated that both the Langmuir-Hinshelwood and Mars-van-Krevelen mechanisms play an important role in the oxidation of carbon monoxide under ambient conditions.

| S-EPMC8517956 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data