Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Investigation of putative active-site lysine residues in hydroxymethylbilane synthase. Preparation and characterization of mutants in which (a) Lys-55, (b) Lys-59 and (c) both Lys-55 and Lys-59 have been replaced by glutamine.

ABSTRACT: A new construct carrying the hemC gene was transformed into Escherichia coli, resulting in approx. 1000-fold over-expression of hydroxymethylbilane synthase (HMBS). This construct was used to generate HMBS in which (a) Lys-55, (b) Lys-59 and (c) both Lys-55 and Lys-59 were replaced by glutamine (K55Q, K59Q and K55Q-K59Q respectively). All three modified enzymes are chromatographically separable from wild-type enzyme. Kinetic studies showed that the substitution K55Q has little effect whereas K59Q causes a 25-fold decrease in Kapp. cat./Kapp. m. Treatment of K55Q, K59Q and K55Q-K59Q separately with pyridoxal 5'-phosphate and NaBH4 resulted in incomplete and non-specific reaction with the remaining lysine residues. Pyridoxal modification of Lys-59 in the K55Q mutant caused greater enzymic inactivation than similar modification of Lys-55 in K59Q. The results in sum show that, though Lys-55 and Lys-59 may be at or near the active site, neither is indispensable for the catalytic activity of HMBS.

SUBMITTER: Hadener A

PROVIDER: S-EPMC1149581 | biostudies-other | 1990 Oct

REPOSITORIES: biostudies-other

ACCESS DATA

Json Xml

Similar Datasets

Evidence that pyridoxal phosphate modification of lysine residues (Lys-55 and Lys-59) causes inactivation of hydroxymethylbilane synthase (porphobilinogen deaminase).

Project description:A recombinant strain of Escherichia coli has been constructed that produces approx. 200 times the amount of hydroxymethylbilane synthase found in wild-type E. coli [Hart, Abell & Battersby (1986) Biochem. J. 240, 273-276]. Enzyme purified from this strain is shown to be permanently inactivated by pyridoxal 5'-phosphate/NaB1H3(3)H1. The inactivation is not complete despite the fact that approx. 1 mol of lysine residues is modified per mol of enzyme. Evidence is gained showing that (a) modification of one of two conserved lysine residues (Lys-55 or Lys-59) results in inactivation of hydroxymethylbilane synthase and (b) these lysine residues are present in or close to the active site.

| S-EPMC1133237 | biostudies-other

Distinct specificities of the HEMK2 protein methyltransferase in methylation of glutamine and lysine residues.

Project description:The HEMK2 protein methyltransferase has been described as glutamine methyltransferase catalyzing ERF1-Q185me1 and lysine methyltransferase catalyzing H4K12me1. Methylation of two distinct target residues is unique for this class of enzymes. To understand the specific catalytic adaptations of HEMK2 allowing it to master this chemically challenging task, we conducted a detailed investigation of the substrate sequence specificities of HEMK2 for Q- and K-methylation. Our data show that HEMK2 prefers methylation of Q over K at peptide and protein level. Moreover, the ERF1 sequence is strongly preferred as substrate over the H4K12 sequence. With peptide SPOT array methylation experiments, we show that Q-methylation preferentially occurs in a G-Q-X3 -R context, while K-methylation prefers S/T at the first position of the motif. Based on this, we identified novel HEMK2 K-methylation peptide substrates with sequences taken from human proteins which are methylated with high activity. Since H4K12 methylation by HEMK2 was very low, other protein lysine methyltransferases were examined for their ability to methylate the H4K12 site. We show that SETD6 has a high H4K12me1 methylation activity (about 1000-times stronger than HEMK2) and this enzyme is mainly responsible for H4K12me1 in DU145 prostate cancer cells.

| S-EPMC10804810 | biostudies-literature

Role of the C-terminal lysine residues of streptococcal surface enolase in Glu- and Lys-plasminogen-binding activities of group A streptococci.

Project description:Streptococcal surface enolase (SEN) is a major plasminogen-binding protein of group A streptococci. Our earlier biochemical studies have suggested that the region responsible for this property is likely located at the C-terminal end of the SEN molecule. In the present study, the gene encoding SEN was cloned from group A streptococci M6 isolate D471. A series of mutations in the sen gene corresponding to the C-terminal region (428KSFYNLKK435) of the SEN molecule were created by either deleting one or more terminal lysine residues or replacing them with leucine. All purified recombinant SEN proteins with altered C-terminal ends were found to be enzymatically active and were analyzed for their Glu- and Lys-plasminogen-binding activities. Wild-type SEN bound to Lys-plasminogen with almost three times more affinity than to Glu-plasminogen. However, the recombinant mutant SEN proteins with a deletion of Lys434-435 or with K435L and K434-435L replacements showed a significant decrease in Glu- and Lys-plasminogen-binding activities. Accordingly, a streptococcal mutant expressing SEN-K434-435L showed a significant decrease in Glu- and Lys-plasminogen-binding activities. Biochemical and functional analyses of the isogenic mutant strain revealed a significant decrease in its abilities to cleave a chromogenic tripeptide substrate, acquire plasminogen from human plasma, and penetrate the extracellular matrix. Together, these data indicate that the last two C-terminal lysine residues of surface-exposed SEN contribute significantly to the plasminogen-binding activity of intact group A streptococci and hence to their ability to exploit host properties to their own advantage in tissue invasion.

| S-EPMC343989 | biostudies-literature

Human hydroxymethylbilane synthase: Molecular dynamics of the pyrrole chain elongation identifies step-specific residues that cause AIP.

Project description:Hydroxymethylbilane synthase (HMBS), the third enzyme in the heme biosynthetic pathway, catalyzes the head-to-tail condensation of four molecules of porphobilinogen (PBG) to form the linear tetrapyrrole 1-hydroxymethylbilane (HMB). Mutations in human HMBS (hHMBS) cause acute intermittent porphyria (AIP), an autosomal-dominant disorder characterized by life-threatening neurovisceral attacks. Although the 3D structure of hHMBS has been reported, the mechanism of the stepwise polymerization of four PBG molecules to form HMB remains unknown. Moreover, the specific roles of each of the critical active-site residues in the stepwise enzymatic mechanism and the dynamic behavior of hHMBS during catalysis have not been investigated. Here, we report atomistic studies of HMB stepwise synthesis by using molecular dynamics (MD) simulations, mutagenesis, and in vitro expression analyses. These studies revealed that the hHMBS active-site loop movement and cofactor turn created space for the elongating pyrrole chain. Twenty-seven residues around the active site and water molecules interacted to stabilize the large, negatively charged, elongating polypyrrole. Mutagenesis of these active-site residues altered the binding site, hindered cofactor binding, decreased catalysis, impaired ligand exit, and/or destabilized the enzyme. Based on intermediate stages of chain elongation, R26 and R167 were the strongest candidates for proton transfer to deaminate the incoming PBG molecules. Unbiased random acceleration MD simulations identified R167 as a gatekeeper and facilitator of HMB egress through the space between the enzyme's domains and the active-site loop. These studies identified the specific active-site residues involved in each step of pyrrole elongation, thereby providing the molecular bases of the active-site mutations causing AIP.

| S-EPMC5924904 | biostudies-literature

Impaired replication elongation in Tetrahymena mutants deficient in histone H3 Lys 27 monomethylation.

Project description:Replication of nuclear DNA occurs in the context of chromatin and is influenced by histone modifications. In the ciliate Tetrahymena thermophila, we identified TXR1, encoding a histone methyltransferase. TXR1 deletion resulted in severe DNA replication stress, manifested by the accumulation of ssDNA, production of aberrant replication intermediates, and activation of robust DNA damage responses. Paired-end Illumina sequencing of ssDNA revealed intergenic regions, including replication origins, as hot spots for replication stress in ?TXR1 cells. ?TXR1 cells showed a deficiency in histone H3 Lys 27 monomethylation (H3K27me1), while ?EZL2 cells, deleting a Drosophila E(z) homolog, were deficient in H3K27 di- and trimethylation, with no detectable replication stress. A point mutation in histone H3 at Lys 27 (H3 K27Q) mirrored the phenotype of ?TXR1, corroborating H3K27me1 as a key player in DNA replication. Additionally, we demonstrated interactions between TXR1 and proliferating cell nuclear antigen (PCNA). These findings support a conserved pathway through which H3K27me1 facilitates replication elongation.

| S-EPMC3744725 | biostudies-literature

Nonenzymatic acetylation of ubiquitin Lys side chains is modulated by their neighboring residues.

Project description:Nonenzymatic acetylation of Lys side chains (Lys-SCs) by various in vivo reactive molecules has been suggested to play novel regulatory roles. Ubiquitin (UB) has seven Lys residues that are utilized for synthesis of specific poly-UB chains. To understand the nature of these Lys-SC modifications, the chemical acetylation rate and pKa and Hill coefficient of each UB-Lys-SC were measured. Mutagenesis studies combined with the determination of activation energy indicated that specific neighboring residues of the Lys-SCs have a potential catalytic activity during nonenzymatic acetylation. Based on the shared chemistry between nonenzymatic Lys acetylation and ubiquitylation, the characterized chemical properties of the UB-Lys-SCs could be a reference for deciphering both mechanisms. Our NMR approaches could be useful for studying general nonenzymatic Lys acylations of various proteins.

| S-EPMC5947880 | biostudies-literature

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.

Project description:RATIONALE:Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation. PATIENT CONCERNS:A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia. DIAGNOSES:She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome. INTERVENTIONS:The proband was treated with intravenous glucose (at least 250?g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing. OUTCOMES:A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability. LESSONS:Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.

| S-EPMC6156069 | biostudies-literature

A new type of protein lysine methyltransferase trimethylates Lys-79 of elongation factor 1A.

Project description:The elongation factors of Saccharomyces cerevisiae are extensively methylated, containing a total of ten methyllysine residues. Elongation factor methyltransferases (Efm1, Efm2, Efm3, and Efm4) catalyze at least four of these modifications. Here we report the identification of a new type of protein lysine methyltransferase, Efm5 (Ygr001c), which was initially classified as N6-adenine DNA methyltransferase-like. Efm5 is required for trimethylation of Lys-79 on EF1A. We directly show the loss of this modification in efm5? strains by both mass spectrometry and amino acid analysis. Close homologs of Efm5 are found in vertebrates, invertebrates, and plants, although some fungal species apparently lack this enzyme. This suggests possible unique functions of this modification in S. cerevisiae and higher eukaryotes. The misannotation of Efm5 was due to the presence of a DPPF sequence in post-Motif II, typically associated with DNA methylation. Further analysis of this motif and others like it demonstrates a potential consensus sequence for N-methyltransferases.

| S-EPMC4263273 | biostudies-literature

Arginine and Lysine interactions with ? residues in metalloproteins.

Project description:Metalloproteins have many different functions in cells such as enzymes; signal transduction, transport and storage proteins. About one third of all proteins require metals to carry out their functions. In the present study we have analyzed the roles played by Arg and Lys (cationic side chains) interactions with ? (Phe, Tyr or Trp) residues and their role in the structural stability of metalloproteins. These interactions might play an important role in the global conformational stability in metalloproteins. In spite of its lower natural occurrence (1.76%) the number of Trp residues involved in energetically significant interactions is higher in metalloproteins.

| S-EPMC3488845 | biostudies-literature

Computational Studies on the Nonenzymatic Deamidation Mechanisms of Glutamine Residues.

Project description:The nonenzymatic deamidation reactions of asparagine (Asn) and glutamine (Gln) residues in proteins are associated with protein turnover and age-related diseases. The reactions are also believed to provide a molecular clock for biological processes. Although Gln deamidation is assumed to occur through the glutarimide intermediate, the mechanisms for this are unclear because under normal physiological conditions, Gln deamidation occurs relatively less frequently and at a lower rate than Asn deamidation. We investigate the mechanisms underlying glutarimide formation from Gln residues, which proceeds in two steps (cyclization and deammoniation) catalyzed by phosphate and carbonate. We also compare these reactions with noncatalytic mechanisms and water-catalyzed mechanisms. The calculations were performed on the model compound Ace-Gln-Nme (Ace = acetyl, Nme = methylamino) using the density functional theory with the B3LYP/6-31+G(d,p) level of theory. Our results suggest that all the catalysts used in our study can mediate the proton relays required for glutarimide formation. We further determined that the calculated activation barriers of the reactions catalyzed by phosphate ions (115 kJ mol-1) and carbonate ions (112 kJ mol-1) are sufficiently low for the reactions to occur under normal physiological conditions. We also show that nucleophilic enhancement of Nme nitrogen is essential for the cyclization of Gln residues.

| S-EPMC6648516 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data