Dataset Information

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

ABSTRACT: A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus.

SUBMITTER: Muniesa-Perez M

PROVIDER: S-EPMC168050 | biostudies-other | 1996 Jul

REPOSITORIES: biostudies-other

ACCESS DATA

Publications

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

Muniesa-Pérez M M Jofre J J Blanch A R AR

Applied and environmental microbiology 19960701 7

A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bri ...[more]

PMID: 8779607

Similar Datasets

Project description:The dynamic nature of Vibrio parahaemolyticus epidemiology has presented a unique challenge for disease intervention strategies. Despite the continued rise of disease incidence and outbreaks of vibriosis, as well as the global emergence of pandemic clones and serovariants with enhanced virulence, there is a paucity of molecular methods for the serotyping of V. parahaemolyticus strains to improve disease surveillance and outbreak investigations. We describe the development of a multiplex ligation reaction based on probe melting curve analysis (MLMA) for the simultaneous identification of 11 clinically most common V. parahaemolyticus serotypes spanning a 10-year period. Through extensive sequence analyses using 418 genomes, specific primers and probes were designed for a total of 22 antigen gene targets for the O- and K- serogroups. Additionally, the toxR gene was incorporated into the assay for the confirmation of V. parahaemolyticus. All gene targets were detected by the assay and gave expected Tm values, without any cross reactions between the 11 clinically common serotypes or with 38 other serotypes. The limit of identification for all gene targets ranged from 0.1 to 1 ng/?L. The intra- and inter-assay standard deviations and the coefficients of variation were no more than 1°C and <1% respectively, indicating a highly reproducible assay. A multicenter double-blind clinical study was conducted using the traditional V. parahaemolyticus identification workflow and the MLMA assay workflow in parallel. From consecutive diarrheal stool specimens (n = 6118) collected over a year at 10 sentinel hospitals, a total of 153 V. parahaemolyticus isolates (2.5%) were identified by both workflows. A total agreement (kappa = 1.0) between the serotypes identified by the MLMA assay and conventional serological method was demonstrated. This is the first molecular assay to simultaneously identify multiple clinically important V. parahaemolyticus serotypes, which satisfies the acute need for a practical, rapid and robust identification of V. parahaemolyticus serotypes to facilitate the timely detection of vibriosis outbreaks and surveillance.

Project description:A xanthomonad differential medium (designated Xan-D medium) was developed, on which streaks and colonies of xanthomonads, including 13 species of the genus Xanthomonas, turned wet-shining yellow-green and were surrounded with a smaller milky zone and a bigger clear zone in 3 to 4 days. The characteristics could easily be differentiated from those of yellow nonxanthomonads and other bacteria. The mechanism of color change and formation of a milky zone on the medium are mainly due to the Tween 80 hydrolytic capacity of xanthomonads. The gene, estA, responsible for Tween 80 hydrolysis was cloned and expressed in Escherichia coli, which acquired a capacity to hydrolyze Tween 80 and could turn green and form a milky zone on the Xan-D medium. The nucleotide sequence of estA is highly conserved in the xanthomonads, and the sequence was used to design a specific PCR primer set. The PCR amplification using the primer set amplified a 777-bp specific DNA fragment for all xanthomonad strains tested. The Xan-D medium was used to isolate and differentiate Xanthomonas campestris pv. campestris from naturally infected cabbages with black rot symptoms for a rapid diagnosis. All isolated X. campestris pv. campestris strains developed characteristic colonies and were positive in the PCR with the estA primer set. The Xan-D medium was further amended with antibiotics and successfully used for the detection of viable X. campestris pv. campestris cells from plant seeds. Although some yellow nonxanthomonads and other saprophytic bacteria from plant seeds could still grow on the medium, they did not interfere with the color development of X. campestris pv. campestris. However, Stenotrophomonas maltophilia, which is closely related to xanthomonads, existing in a seed lot could also develop yellow-green color but had different colony morphology and was negative in the PCR with the estA primer set. Accordingly, the combination of the Xan-D medium with the estA-specific PCR is a useful and reliable method for the isolation and detection of viable xanthomonad cells from plant materials.

Dataset Information

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

Publications

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets