Dataset Information

Pseudoxanthoma elasticum: a clinical, pathophysiological and genetic update including 11 novel ABCC6 mutations.

ABSTRACT: Pseudoxanthoma elasticum (PXE) is an inherited systemic disease of connective tissue primarily affecting the skin, retina, and cardiovascular system. It is characterised pathologically by elastic fibre mineralisation and fragmentation (so called "elastorrhexia"), and clinically by high heterogeneity in age of onset and the extent and severity of organ system involvement. PXE was recently associated with mutations in the ABCC6 (ATP binding cassette subtype C number 6) gene. At least one ABCC6 mutation is found in about 80% of patients. These mutations are identifiable in most of the 31 ABCC6 exons and consist of missense, nonsense, frameshift mutations, or large deletions. No correlation between the nature or location of the mutations and phenotype severity has yet been established. Recent findings support exclusive recessive inheritance. The proposed prevalence of PXE is 1/25,000, but this is probably an underestimate. ABCC6 encodes the protein ABCC6 (also known as MRP6), a member of the large ATP dependent transmembrane transporter family that is expressed predominantly in the liver and kidneys, and only to a lesser extent in tissues affected by PXE. The physiological substrates of ABCC6 remain to be determined, but the current hypothesis is that PXE should be considered to be a metabolic disease with undetermined circulating molecules interacting with the synthesis, turnover, or maintenance of elastic fibres.

SUBMITTER: Chassaing N

PROVIDER: S-EPMC1735972 | biostudies-other | 2005 Dec

REPOSITORIES: biostudies-other

ACCESS DATA

Publications

Pseudoxanthoma elasticum: a clinical, pathophysiological and genetic update including 11 novel ABCC6 mutations.

Chassaing N N Martin L L Calvas P P Le Bert M M Hovnanian A A

Journal of medical genetics 20050513 12

Pseudoxanthoma elasticum (PXE) is an inherited systemic disease of connective tissue primarily affecting the skin, retina, and cardiovascular system. It is characterised pathologically by elastic fibre mineralisation and fragmentation (so called "elastorrhexia"), and clinically by high heterogeneity in age of onset and the extent and severity of organ system involvement. PXE was recently associated with mutations in the ABCC6 (ATP binding cassette subtype C number 6) gene. At least one ABCC6 mut ...[more]

PMID: 15894595

Similar Datasets

Project description:BackgroundGoltz syndrome (GS) is a X-linked disorder defined by defects of mesodermal- and ectodermal-derived structures and caused by PORCN mutations. Features include striated skin-pigmentation, ocular and skeletal malformations and supernumerary or hypoplastic nipples. Generally, GS is associated with in utero lethality in males and most of the reported male patients show mosaicism (only three non-mosaic surviving males have been described so far). Also, precise descriptions of neurological deficits in GS are rare and less severe phenotypes might not only be caused by mosaicism but also by less pathogenic mutations suggesting the need of a molecular genetics and functional work-up of these rare variants.ResultsWe report two cases: one girl suffering from typical skin and skeletal abnormalities, developmental delay, microcephaly, thin corpus callosum, periventricular gliosis and drug-resistant epilepsy caused by a PORCN nonsense-mutation (c.283C > T, p.Arg95Ter). Presence of these combined neurological features indicates that CNS-vulnerability might be a guiding symptom in the diagnosis of GS patients. The other patient is a boy with a supernumerary nipple and skeletal anomalies but also, developmental delay, microcephaly, cerebral atrophy with delayed myelination and drug-resistant epilepsy as predominant features. Skin abnormalities were not observed. Genotyping revealed a novel PORCN missense-mutation (c.847G > C, p.Asp283His) absent in the Genome Aggregation Database (gnomAD) but also identified in his asymptomatic mother. Given that non-random X-chromosome inactivation was excluded in the mother, fibroblasts of the index had been analyzed for PORCN protein-abundance and -distribution, vulnerability against additional ER-stress burden as well as for protein secretion revealing changes.ConclusionsOur combined findings may suggest incomplete penetrance for the p.Asp283His variant and provide novel insights into the molecular etiology of GS by adding impaired ER-function and altered protein secretion to the list of pathophysiological processes resulting in the clinical manifestation of GS.

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Project description:Owing to an early and marked deposition of amyloid-β in the basal ganglia, autosomal dominant Alzheimer's disease could distinctly involve motor symptoms. Therefore, we aimed to assess the prevalence and characteristics of motor signs in autosomal dominant Alzheimer's disease. Baseline Unified Parkinson Disease Rating Scale part three scores (UPDRS-III) from 433 participants of the Dominantly Inherited Alzheimer's Network observational study were analysed. Motor symptoms were scrutinized with respect to associations with mutation carrier status, mutation site within PSEN1, basal ganglia amyloid-β as measured by Pittsburgh compound B PET, estimated years to symptom onset and Clinical Dementia Rating Scale-Sum of Boxes. Motor findings in mutation carriers were compared to patients with sporadic Alzheimer's disease using data of the National Alzheimer's Coordination Center. Mutation carriers showed motor findings at a higher frequency (28.4% versus 12.8%; P < 0.001) and severity (mean UPDRS-III scores 2.0 versus 0.4; P < 0.001) compared to non-carriers. Eleven of the 27 UPDRS-III items were statistically more frequently affected in mutation carriers after adjustment for multiple comparisons. Ten of these 11 items were subscale components of bradykinesia. In cognitively asymptomatic mutation carriers, dysdiadochokinesia was more frequent compared to non-carriers (right hand: 3.8% versus 0%; adjusted P = 0.023; left: 4.4% versus 0.6%; adjusted P = 0.031). In this cohort, the positive predictive value for mutation carrier status in cognitively asymptomatic participants (50% a priori risk) of dysdiadochokinesia was 100% for the right and 87.5% for the left side. Mutation carriers with motor findings more frequently were basal ganglia amyloid-β positive (84% versus 63.3%; P = 0.006) and showed more basal ganglia amyloid-β deposition (Pittsburgh compound B-standardized uptake value ratio 2.472 versus 1.928; P = 0.002) than those without. Frequency and severity of motor findings were greater in post-codon 200 PSEN1 mutations (36%; mean UPDRS-III score 3.03) compared to mutations pre-codon 200 PSEN1 (19.3%, P = 0.022; 0.91, P = 0.013). In mutation carriers, motor symptom severity was significantly positively correlated with basal ganglia amyloid-β deposition, Clinical Dementia Rating scores and estimated years to symptom onset. Mutation carriers with a Clinical Dementia Rating global score of 2 exhibited more pronounced motor symptoms than sporadic Alzheimer's disease patients with the same Clinical Dementia Rating global score (mean UPDRS-III scores 20.71 versus 5.96; P < 0.001). With a prevalence of approximately 30% and increasing severity with progression of dementia, motor symptoms are proven as a clinically relevant finding in autosomal dominant Alzheimer's disease, in particular in advanced dementia stages, that correlates with deposition of amyloid-β in the basal ganglia. In a very small per cent of cognitively asymptomatic members of families with autosomal dominant Alzheimer's disease, dysdiadochokinesia may increase the chance of an individual's status as mutation carrier.

Dataset Information

Pseudoxanthoma elasticum: a clinical, pathophysiological and genetic update including 11 novel ABCC6 mutations.

Publications

Pseudoxanthoma elasticum: a clinical, pathophysiological and genetic update including 11 novel ABCC6 mutations.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets