Evaluation of sperm's chromatin quality with acridine orange test, chromomycin A3 and aniline blue staining in couples with unexplained recurrent abortion.
Ontology highlight
ABSTRACT:
SUBMITTER: Kazerooni T
PROVIDER: S-EPMC2799558 | biostudies-other | 2009 Nov-Dec
REPOSITORIES: biostudies-other
Similar Datasets
Project description:BACKGROUND:Rapid diagnosis of malaria using acridine orange (AO) staining and a light microscope with a halogen lamp and interference filter was deployed in some malaria-endemic countries. However, it has not been widely adopted because: (1) the lamp was weak as an excitation light and the set-up did not work well under unstable power supply; and, (2) the staining of samples was frequently inconsistent. METHODS:The halogen lamp was replaced by a low-cost, blue light-emitting diode (LED) lamp. Using a reformulated AO solution, the staining protocol was revised to make use of a concentration gradient instead of uniform staining. To evaluate this new AO diagnostic system, a pilot field study was conducted in the Lake Victoria basin in Kenya. RESULTS:Without staining failure, malaria infection status of about 100 samples was determined on-site per one microscopist per day, using the improved AO diagnostic system. The improved AO diagnosis had both higher overall sensitivity (46.1 vs 38.9%: p = 0.08) and specificity (99.0 vs 96.3%) than the Giemsa method (N = 1018), using PCR diagnosis as the standard. CONCLUSIONS:Consistent AO staining of thin blood films and rapid evaluation of malaria parasitaemia with the revised protocol produced superior results relative to the Giemsa method. This AO diagnostic system can be set up easily at low cost using an ordinary light microscope. It may supplement rapid diagnostic tests currently used in clinical settings in malaria-endemic countries, and may be considered as an inexpensive tool for case surveillance in malaria-eliminating countries.
| S-EPMC5804042 | biostudies-literature
Project description:Human bladder cancer (BC) cells exhibit a high basal level of autophagic activity with accumulation of acridine-orange(AO)-stained acidic vesicular organelles. The rapid AO relocalization was observed in treated BC cells under blue-light emission. To investigate the cytotoxic effects of AO on human BC cell lines under blue-light exposure, human immortalized uroepithelial (SV-Huc-1) and BC cell lines (5637 and T24) were treated with indicated concentrations of AO or blue-light exposure alone and in combination. The cell viability was then determined using WST-1, time-lapse imaging with a Cytosmart System and continuous quantification with a multi-mode image-based reader. Treatment of AO or blue-light exposure alone did not cause a significant loss of viability in BC cells. However, AO exhibited a dose-dependent increment of cytotoxicity toward BC cells under blue-light exposure. Furthermore, the tumor formation of BC cells with treatment was significantly reduced when evaluated in a mouse xenograft model. The photodamage caused by AO was nearly neglected in SV-Huc-1 cells, suggesting a differential effect of this treatment between cancer and normal cells. In summary, AO, as a photosensitizer, disrupts acidic organelles and induces cancer cell death in BC cells under blue-light irradiation. Our findings may serve as a novel therapeutic strategy against human BC.
| S-EPMC5658329 | biostudies-literature
Project description:A urinary tract infection (UTI) can be diagnosed via urinalysis, consisting of a dipstick test and manual microscopic examination. Point-of-care (POC) image-based systems have been designed to automate the microscopic examination for low-volume laboratories or low-resource clinics. In this pilot study, acridine orange (AO) was evaluated as a fluorescence-based contrast agent to aid in detecting and enumerating urine sediment specific for diagnosing a UTI. Acridine orange staining of epithelial cells, leukocytes, and bacteria provided sufficient contrast to successfully implement image segmentation techniques, which enabled the extraction of classifiable morphologic features. Surface area bounded by each cell border was used to differentiate the sediment; epithelial cells were larger than 500?m2, bacteria were less than 30?m2, and leukocytes in between. This image-based semi-automated technique using AO resulted in similar cell counts to the clinical results, which demonstrates the feasibility of AO as an aid for POC urinalysis systems.
| S-EPMC6787640 | biostudies-literature
Project description:The chromatin observed by conventional electron microscopy under the nuclear envelope constitutes a single layer of dense 30-35 nm granules, while ?30 nm fibrils laterally attached to them, form large patches of lamin-associated domains (LADs). This particular surface "epichromatin" can be discerned by specific (H2A+H2B+DNA) conformational antibody at the inner nuclear envelope and around mitotic chromosomes. In order to differentiate the DNA conformation of the peripheral chromatin we applied an Acridine orange (AO) DNA structural test involving RNAse treatment and the addition of AO after acid pre-treatment. MCF-7 cells treated in this way revealed yellow/red patches of LADs attached to a thin green nuclear rim and with mitotic chromosomes outlined in green, topologically corresponding to epichromatin epitope staining by immunofluorescence. Differentially from LADs, the epichromatin was unable to provide metachromatic staining by AO, unless thermally denatured at 94oC. DNA enrichment in GC stretches has been recently reported for immunoprecipitated ? 1Kb epichromatin domains. Together these data suggest that certain epichromatin segments assume the relatively hydrophobic DNA A-conformation at the nuclear envelope and surface of mitotic chromosomes, preventing AO side dimerisation. We hypothesize that epichromatin domains form nucleosome superbeads. Hydrophobic interactions stack these superbeads and align them at the nuclear envelope, while repulsing the hydrophilic LADs. The hydrophobicity of epichromatin explains its location at the surface of mitotic chromosomes and its function in mediating chromosome attachment to the restituting nuclear envelope during telophase.
| S-EPMC5973139 | biostudies-literature
Project description:Simultaneous non-invasive visualization of blood vessels and nerves in patients can be obtained in the eye. The retinal vasculature is a target of many retinopathies. Inflammation, readily manifest by leukocyte adhesion to the endothelial lining, is a key pathophysiological mechanism of many retinopathies, making it a valuable and ubiquitous target for disease research. Leukocyte fluorography has been extensively used in the past twenty years; however, fluorescent markers, visualization techniques, and recording methods have differed between studies. The lack of detailed protocol papers regarding leukocyte fluorography, coupled with lack of uniformity between studies, has led to a paucity of standards for leukocyte transit (velocity, adherence, extravasation) in the retina. Here, we give a detailed description of a convenient method using acridine orange (AO) and a commercially available scanning laser ophthalmoscope (SLO, HRA-OCT Spectralis) to view leukocyte behavior in the mouse retina. Normal mice are compared to mice with acute and chronic inflammation. This method can be readily adopted in many research labs.
| S-EPMC3943592 | biostudies-literature
Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.
| S-EPMC9201170 | biostudies-literature
Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.
| S-EPMC10280933 | biostudies-literature
Project description:Human leukocyte antigen-E (HLA-E)is a non-classical major histocompatibility complex (MHC) class I antigens which expressed on extra villous cytotrophoblast, which interacts with NKG2A, is an inhibitory receptor on natural killer (NK) cells and leading to down regulation of immune response in the maternal-fetal interface and provides maternal immune tolerance of the fetus.This study was designated to investigate the gene frequencies of E0101 and E0103 in HLA-E gene in Iranian women with recurrent spontaneous abortion (RSA).Amplification Refractory Mutation System (ARMS-PCR) technique was carried out to detect polymorphism in exon 3 of the HLA-E gene in women with RSA and controls (n=200). Differences between groups were analyzed by SPSS19 software using (2) test.There was no significant difference in the allele frequencies of the HLA-E polymorphism between RSA and fertile controls but HLA-E 0101/0103 heterozygous genotype was found to be significantly higher in RSA group (p=0.006, OR=1.73), so this genotype might confer susceptibility to RSA.Our results suggest that HLA-E 0101/0103 heterozygous genotype leads to increase of RSA risk. It seems that by genotyping of HLA-E polymorphism, we can predict the risk of RSA in infertile women.
| S-EPMC4971558 | biostudies-other
Project description:BACKGROUND:Recurrent Spontaneous Abortion (RSA) is caused by multiple genetic and non-genetic factors. Around 50% of the RSA cases have no known etiology and are considered as Unexplained RSA (URSA). Estrogens, via binding to their receptors, play an important role in female reproduction. This study aimed to investigate whether single nucleotide polymorphisms (SNPs; +1082G/A, +1730G/A and rs1256030 C/T) in the estrogen receptor beta (ESR2) gene are associated with susceptibility to URSA in a population of Iranian women. METHODS:In this case-control study, the study groups consisted of 240 subjects with a history of URSA and 102 fertile women as controls. Serum levels of follicle stimulating hormone (FSH), luteinizing hormone (LH), and estradiol (E2) were measured on day 2-3 of menstrual cycle. Two functional SNPs, +1082G/A (a silent mutation in exon 5) and +1730G/A (3' untranslated region of the exon 8), and one intron, rs1256030C/T, in the ESR2 gene were genotyped, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. RESULTS:Serum levels of LH were significantly increased in URSA women. No significant differences in distribution of +1082G/A, +1730G/A and rs1256030C/T between URSA and control groups were observed. CONCLUSION:Our findings suggest that the studied SNPs on ESR2 gene may not be associated with URSA.
| S-EPMC5501144 | biostudies-literature
Project description:Unexplained recurrent spontaneous abortion (URSA) is one of the most intractable clinical challenges in reproduction. As a specific type of endogenous non-coding RNA, circular RNAs (circRNAs) have great pre-clinical diagnostic and therapeutic values in diseases. Recently, thousands of circRNAs were detected in human pre-implantation embryos, indicating that circRNAs potentially have important regulatory functions. However, the roles of circRNAs in URSA remain largely unknown. In this study, we elucidated deregulated circRNA expression and distinct competing endogenous RNA (ceRNA) networks by comparing URSA placental villus with that of patients with normal pregnancy using microarrays. We characterized a distinct circRNA, circRNA-0050703, which is downregulated in URSA placental villus (thus we named it circRNA-DURSA). Silencing of circRNA-DURSA results in trophoblast cell apoptosis in vitro. Furthermore, mechanistic dissection revealed that circRNA-DURSA exerts its effects by competitively binding to miR-760, which post-transcriptionally targets HIST1H2BE. Additionally, after circRNA-DURSA silencing in vivo, the numbers of implanted embryos decreased significantly. These results reveal the regulatory roles of circRNA-DURSA in trophoblasts and identified a distinct circRNA-DURSA/miR-760/HIST1H2BE axis as potentially important diagnostic and therapeutic targets for URSA treatment.
| S-EPMC8655312 | biostudies-literature