Dataset Information

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

ABSTRACT: We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

SUBMITTER: Lisziewicz J

PROVIDER: S-EPMC331174 | biostudies-other | 1990 Jul

REPOSITORIES: biostudies-other

ACCESS DATA

Publications

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

Lisziewicz J J Brown J J Breviario D D Sreenath T T Ahmed N N Koller R R Dhar R R

Nucleic acids research 19900701 14

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for m ...[more]

PMID: 2198534

Similar Datasets

Project description:Saccharomyces cerevisiae is one of the premier model systems for studying the genomics and evolution of transposable elements. The availability of the S. cerevisiae genome led to unprecedented insights into its five known transposable element families (the LTR retrotransposons Ty1-Ty5) in the years shortly after its completion. However, subsequent advances in bioinformatics tools for analysing transposable elements and the recent availability of genome sequences for multiple strains and species of yeast motivates new investigations into Ty evolution in S. cerevisiae. Here we provide a comprehensive phylogenetic and population genetic analysis of all Ty families in S. cerevisiae based on a systematic re-annotation of Ty elements in the S288c reference genome. We show that previous annotation efforts have underestimated the total copy number of Ty elements for all known families. In addition, we identify a new family of Ty3-like elements related to the S. paradoxus Ty3p which is composed entirely of degenerate solo LTRs. Phylogenetic analyses of LTR sequences identified three families with short-branch, recently active clades nested among long branch, inactive insertions (Ty1, Ty3, Ty4), one family with essentially all recently active elements (Ty2) and two families with only inactive elements (Ty3p and Ty5). Population genomic data from 38 additional strains of S. cerevisiae show that the majority of Ty insertions in the S288c reference genome are fixed in the species, with insertions in active clades being predominantly polymorphic and insertions in inactive clades being predominantly fixed. Finally, we use comparative genomic data to provide evidence that the Ty2 and Ty3p families have arisen in the S. cerevisiae genome by horizontal transfer. Our results demonstrate that the genome of a single individual contains important information about the state of TE population dynamics within a species and suggest that horizontal transfer may play an important role in shaping the genomic diversity of transposable elements in unicellular eukaryotes.

Dataset Information

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

Publications

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets