DNA based identification of medicinal materials in Chinese patent medicines.
Ontology highlight
ABSTRACT:
SUBMITTER: Chen R
PROVIDER: S-EPMC3518818 | biostudies-other | 2012
REPOSITORIES: biostudies-other
Publications
DNA based identification of medicinal materials in Chinese patent medicines.
Chen Rong R Dong Juan J Cui Xin X Wang Wei W Yasmeen Afshan A Deng Yun Y Zeng Xiaomao X Tang Zhuo Z
Scientific reports 20121211
Chinese patent medicines (CPM) are highly processed and easy to use Traditional Chinese Medicine (TCM). The market for CPM in China alone is tens of billions US dollars annually and some of the CPM are also used as dietary supplements for health augmentation in the western countries. But concerns continue to be raised about the legality, safety and efficacy of many popular CPM. Here we report a pioneer work of applying molecular biotechnology to the identification of CPM, particularly well refin ...[more]
Similar Datasets
Project description:IntroductionThe prevalence of eye diseases has been increasing worldwide. In China, in addition to conventional medicine, Traditional Chinese Medicine (TCM) plays an important role in maintaining people's vision health. Although less flexible and targeted than TCM decoction, Chinese Patent Medicines (CPMs) are stable and well used. In recent years, CPMs have been increasingly used in ophthalmology clinics by TCM practitioners and by Western doctors in general hospitals. However, comprehensive evidence for using CPMs in ophthalmology is lacking.AimWe will apply the methodology of scoping review to systematically search and sort out the available evidence on oral CPMs for the treatment of eye diseases, identify the distribution of evidence in this field and provide a basis for clinical practice and medical decisions.MethodsThe scoping review will be implemented in the following seven steps: (1) defining the research question; (2) searching National Essential Medicines List (2018 edition), National Basic Medical Insurance, Work Injury Insurance and Maternity Insurance Drug Catalog (2020 edition) and Chinese Pharmacopoeia (2020 edition) for oral CPMs for the treatment of eye diseases; (3) searching Embase, Web of Science, PubMed, Cochrane Library, Chongqing VIP Chinese Scientific Journals Database, Chinese National Knowledge Infrastructure, Chinese Biomedical Literature Database and Wanfang Database for relevant literature published from inception to December 2021; (4) developing eligibility criteria; (5) screening the studies based on inclusion criteria; (6) extracting relevant data and lastly, (7) collating, summarising and reporting the results.Ethics and disseminationSince the scoping review aims at collecting data from publicly available publications, this study does not require ethical approval. The results will be published in a peer-reviewed journal and presented at scientific conferences.
| S-EPMC9214408 | biostudies-literature
Project description:Schisandrae Chinensis Fructus (Wuweizi) is often adulterated with Schisandrae Sphenantherae Fructus (Nanwuweizi) in the herbal market. This adulteration is a threat to clinical treatment and safety. In this study, we aimed to develop a nucleotide signature for the identification of Wuweizi and its Chinese patent medicines based on the mini-DNA barcoding technique. We collected 49 samples to obtain internal transcribed spacer 2 (ITS2) sequences and developed a 26-bp nucleotide signature (5'-CGCTTTGCGACGCTCCCCTCCCTCCC-3') on the basis of a single nucleotide polymorphism (SNP) site within the ITS2 region that is unique to Wuweizi. Then, using the nucleotide signature, we investigated 27 batches of commercial crude drug samples labeled as Wuweizi and eight batches of Chinese patent medicines containing Wuweizi. Results showed that eight commercial crude drug samples were adulterants and one of the Chinese patent medicines contained adulterants. The nucleotide signature can serve as an effective tool for identifying Wuweizi and its Chinese patent medicines and can thus be used to ensure clinical drug safety.
| S-EPMC6562420 | biostudies-literature
Project description:Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
| S-EPMC5517575 | biostudies-literature
Project description:Herbal medicines are used in many countries for maintaining health and treating diseases. Their efficacy depends on the use of the correct materials, and life-threatening poisoning may occur if toxic adulterants or substitutes are administered instead. Identification of a medicinal material at the DNA level provides an objective and powerful tool for quality control. Extraction of high-quality DNA is the first crucial step in DNA authentication, followed by a battery of DNA techniques including whole genome fingerprinting, DNA sequencing and DNA microarray to establish the identity of the material. New or improved technologies have been developed and valuable data have been collected and compiled for DNA authentication. Some of these technologies and data are patentable. This article provides an overview of some recent patents that cover the extraction of DNA from medicinal materials, the amplification of DNA using improved reaction conditions, the generation of DNA sequences and fingerprints, and the development of high-throughput authentication methods. It also briefly explains why these patents have been granted.
| S-EPMC2791102 | biostudies-literature
Project description:BackgroundCoronavirus Disease 2019 (COVID-19) is an emerging and rapidly evolving disease, with no recommended effective anti-coronavirus drug treatment. Traditional Chinese Patent Medicines (CPMs) have, however, been widely used to treat COVID-19 in China, and a number of clinical practice results have shown them to have a significant role in its treatment. Consequently, numerous guidelines and expert consensus have recommended the use of CPMs to treat COVID-19.Aim of the studyThe objectives of this review are to provide up-to-date information on the pharmacology and clinical research on CPMs in the treatment of COVID-19, discuss the research findings, and to better guide clinical application and scientific research on CPMs in the treatment of COVID-19.MethodsThe frequencies of CPM recommendations by guidelines and expert consensus for treatment of COVID-19 in China were ranked. This report identifies the top 10 CPMs, which include Huoxiang Zhengqi capsule (HXZQC), Lianhua Qingwen capsule (LHQWC), Jinhua Qinggan granule (JHQGG), Shufeng Jiedu capsule (SFJDC), Tanreqing injection (TRQI), Xiyanping injection (XYPI), Xuebijing injection (XBJI), Shenfu injection (SFI), Shengmai injection (SMI), and Angong Niuhuang pill (AGNHP). Relevant studies from 2000 to 2020 on these top 10 CPMs, covering usage, dosage, mechanism, curative effect, and precautions, were collected from pharmacopoeia, reports, and theses via library and digital databases (including PubMed, CNKI, Google Scholar, Web of Science, and Elsevier).ResultsThe properties of the top 10 CPMs included antiviral, antibacterial, anti-inflammatory, antipyretic and analgesic, anti-acute lung injury, anti-shock, immune regulation, and enhancement of pulmonary function. In addition, clinical research results and Chinese treatment data showed that the CPMs had good therapeutic efficacy in the treatment of COVID-19, and adverse reactions were minimal.ConclusionsKnowledge of the characteristics of the top 10 CPMs and precautions that should be taken may help clinicians to rationally improve therapeutic efficacy, and promote the role of Chinese Medicine in the control of the COVID-19 global epidemic.
| S-EPMC7396557 | biostudies-literature
Project description:Based on the nationwide survey into inpatients' utilization of the health service covered by China's urban basic medical insurance from 2008 to 2010, we analyzed the use rate, cancer profile and combined use of anticancer Chinese patent medicines (CPMs) on 51,382 insured cancer patients by using statistical, bi-clustering and network methods. We found that 42.4% of 51,382 cancer patients used 33 anticancer CPMs, and 51.7% used 71 anticancer Western medicines (WMs). The CPMs were most often used in lung (52%) and nasopharynx (52%) cancer patients, and least in bladder cancer (21%) and leukemia of unspecified cell type (21%) patients. The cost per patient for all 33 anticancer CPMs was 2069RMB, lower than that of the WMs (3458RMB). The cancer profile of commonly used CPMs and WMs for the top 17 cancers (>500 sampled patients) were provided, indicating anticancer CPMs had a broad spectrum of cancers and lacked selectivity in cancer treatment (CPM mean CV = 49%; WM mean CV = 152%). Moreover, 24.8% of the cancer patients used both CPMs and WMs, and CPM-WM combined use networks were constructed for four major cancers. This first nationwide analysis revealed the use characteristics and herb-drug combined use patterns of insurance covered anticancer CPMs in China. The study offers valuable information to guide future studies of the precision, safety and standard use of CPMs.
| S-EPMC4741999 | biostudies-literature
Project description:IntroductionTraditional Chinese medicine (TCM) has accumulated some experience in curing stable angina pectoris (SAP) and efficacy has been demonstrated. Chinese patent medicines, known as modern dosage forms of TCM, can attain the desired effect in clinical application only with the guidance of TCM syndrome theory. However, due to their use by a large number of persons with little knowledge of TCM theories and practices, their efficacy and reputation have been seriously affected.Method and analysisTwo common syndrome types of SAP in TCM, 'qi deficiency and blood stasis' and 'qi stagnation and blood stasis', will be studied in 144 subjects from four TCM hospitals in Tianjin in China using a partial crossover design. The two syndromes will be broken down into six symptom combinations; patients will select a combination of the most distressing to them, and then will be randomised into two groups. Each group, on the basis of routine medication, will be administered one kind of Chinese patent drug: Qishenyiqi Dripping Pills or Compound Danshen Dripping Pills. The treatment characteristics of the two medicines will be evaluated with the COME-PIO method developed by our research team.Ethics and disseminationThis protocol has been approved by the medical ethics committee of Tianjin University of TCM (registration number TJUTCM-EC20130005). The study is safe and reliable.Trial registration numberChinese clinical trials register ChiCTR-TTRCC-14004406.
| S-EPMC4248088 | biostudies-literature
Project description:BackgroundAcute ischemic stroke (AIS) is characterized by high morbidity, disability, mortality, recurrence, and economic burden. Clinical trials have demonstrated that the clinical efficacy of combining oral Chinese patent medicines (CPMs) with chemical drugs (CDs) is better than that of CDs alone. In this study, we performed a network meta-analysis (NMA) of RCTs to assess the efficacy of different CPMs in combination with CDs in the treatment of AIS.MethodsSearch 6 databases from the beginning to January 10, 2023. The Cochrane Risk of Bias tool assessed the methodological quality of the included studies. The NMA was then performed using the STATA 13.0 program. The surface under the cumulative ranking curve (SUCRA) probability values were applied to rank the studied treatments, and cluster analysis was used to compare the effects of CPMs between 2 different outcomes.ResultsA total of 94 eligible RCTs, involving 9581 participants, were included in this analysis. Nine CPMs, including Nao-mai-li granule (NML), Nao-mai-tai granule (NMT), Qi-long granule (QL), Long-sheng-zhi capsule (LSZ), Nao-xin-tong capsule (NXT), Nao-xue-shu oral liquid (NXS), Tong-xin-luo capsule (TXL), Xiao-shuan-chang-rong capsule (XSCR), and Xue-shuan-xin-mai-ning capsule (XSXMN) were included. Regarding the clinical effective rate, all types of CPMs + CDs treatments were significantly better than CDs treatments alone, with significant differences among the 9 selected CPMs. Compared with CDs, results showed that NXS + CDs performed best in improving clinical effective rate [OR = 4.73; 95% CI: 1.26-17.78; (SUCRA: 76.1%)]. TXL + CDs showed the most effective effect in alleviating National Institutes of Health Stroke Scale (NIHSS) [MD = -3.84; 95% CI: -5.23, -2.45; (SUCRA: 81.6%)]; NXT + CDs were most effective in improving Barthel index [MD = 13.05; 95% CI: 3.98-22.12; (SUCRA: 63.5%)]. Combined with other outcome indicators and the results of cluster analysis, NXS + CDs may assist in the potential optimal treatment regimen for AIS.ConclusionIn conclusion, CPMs were found to be beneficial as adjuvant therapy in patients with AIS. Taking into account the clinical effective rate and other outcomes, NXS + CDs may be the most effective option to improve the condition of AIS patients.
| S-EPMC10589523 | biostudies-literature
Project description:Background: The incidence of Non-alcoholic fatty liver disease (NAFLD) is increasing year by year. Researches showed that Chinese patent medicines (CPMs) had achieved good efficacy in the treatment of Non-alcoholic fatty liver disease. However, the debate on optimum Chinese patent medicine (CPM) persists. Therefore, we conducted a network meta-analysis to objectively compare the efficacy of different Chinese patent medicines in the treatment of Non-alcoholic fatty liver disease. Methods: PubMed, Embase, Cochrane Library, Web of Science, China National Knowledge Infrastructure, Wanfang Database, China Science and Technology Journal Database, and Chinese Biomedical Literature Database were used as databases for RCT researches retrieval. The retrieval time was from establishment of the database to July 2022. After effective data was extracted, Review Manager 5.4 and Cochrane Collaboration System Evaluator's Manual were used to assess bias risk. STATA 16.0 based on frequency theory was used for the network meta-analysis. Results: Totally 39 studies were included, involving 13 Chinese patent medicines, including 4049 patients, of which 42 patients were lost. In terms of improving clinical efficiency rate, Zhibitai capsule was most likely the best choice of Chinese patent medicine for Non-alcoholic fatty liver disease. Liuwei Wuling tablet had the best effect in reducing serum ALT and AST; Gandan Shukang capsule had the best effect in reducing serum GGT; Qianggan capsule had the best effect in reducing serum TG; Dangfei Liganning capsule had the best effect in reducing serum TC. None of the included studies had serious adverse reactions. Conclusion: For patients with Non-alcoholic fatty liver disease in this NMA, Zhibitai capsule, Liuwei Wuling tablet, Gandan Shukang capsule, Qianggan capsule, Dangfei Liganning capsule might be noteworthy. Due to the uclear risk bias, better designed double-blind, multi center and large sample RCTs are needed which resolve the problems of blinding, selective reporting and allocation concealment. Systematic Review Registration: https://www.crd.york.ac.uk/prospero/, identifier CRD42022341240.
| S-EPMC9847677 | biostudies-literature
Project description:BackgroundAn efficient method for the identification of medicinal plant products is now a priority as the global demand increases. This study aims to develop a DNA-based method for the identification and authentication of plant species that can be implemented in the industry to aid compliance with regulations, based upon the economically important Hypericum perforatum L. (St John's Wort or Guan ye Lian Qiao).MethodsThe ITS regions of several Hypericum species were analysed to identify the most divergent regions and PCR primers were designed to anneal specifically to these regions in the different Hypericum species. Candidate primers were selected such that the amplicon produced by each species-specific reaction differed in size. The use of fluorescently labelled primers enabled these products to be resolved by capillary electrophoresis.ResultsFour closely related Hypericum species were detected simultaneously and independently in one reaction. Each species could be identified individually and in any combination. The introduction of three more closely related species to the test had no effect on the results. Highly processed commercial plant material was identified, despite the potential complications of DNA degradation in such samples.ConclusionThis technique can detect the presence of an expected plant material and adulterant materials in one reaction. The method could be simply applied to other medicinal plants and their problem adulterants.
| S-EPMC3464944 | biostudies-literature