Transcriptional regulatory elements downstream of the JunB gene.
Ontology highlight
ABSTRACT:
SUBMITTER: Perez-Albuerne ED
PROVIDER: S-EPMC48105 | biostudies-other | 1993 Dec
REPOSITORIES: biostudies-other
Publications
Transcriptional regulatory elements downstream of the JunB gene.
Perez-Albuerne E D ED Schatteman G G Sanders L K LK Nathans D D
Proceedings of the National Academy of Sciences of the United States of America 19931201 24
JunB is an immediate early transcription factor that is induced by a variety of extracellular signaling agents, including growth factors, phorbol esters, and agents that elevate cyclic AMP. The mechanism of activation of the gene encoding JunB by these agents is not well understood. By using the JunB gene together with flanking DNA in transfection experiments, we show that a serum response element (SRE) and/or a cAMP response element (CRE) downstream of the gene mediate the response of the gene ...[more]
Similar Datasets
Project description:The delivery of cystic fibrosis transmembrane conductance regulator (CFTR) to airway epithelia is a goal of many gene therapy strategies to treat cystic fibrosis. Because the native regulatory elements of the CFTR are not well characterized, the development of vectors with heterologous promoters of varying strengths and specificity would aid in our selection of optimal reagents for the appropriate expression of the vector-delivered CFTR gene. Here we contrasted the performance of several novel gene-regulatory elements. Based on airway expression analysis, we selected putative regulatory elements from BPIFA1 and WDR65 to investigate. In addition, we selected a human CFTR promoter region (? 2 kb upstream of the human CFTR transcription start site) to study. Using feline immunodeficiency virus vectors containing the candidate elements driving firefly luciferase, we transduced murine nasal epithelia in vivo. Luciferase expression persisted for 30 weeks, which was the duration of the experiment. Furthermore, when the nasal epithelium was ablated using the detergent polidocanol, the mice showed a transient loss of luciferase expression that returned 2 weeks after administration, suggesting that our vectors transduced a progenitor cell population. Importantly, the hWDR65 element drove sufficient CFTR expression to correct the anion transport defect in CFTR-null epithelia. These results will guide the development of optimal vectors for sufficient, sustained CFTR expression in airway epithelia.
| S-EPMC3423461 | biostudies-literature
Project description:We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.
| S-EPMC331174 | biostudies-other
Project description:To understand how neurons control the expression of the AMPA receptor subunit GluR2, we cloned the 5' proximal region of the rat gene and investigated GluR2 promoter activity by transient transfection. RNase protection and primer extension of rat brain mRNA revealed multiple transcription initiation sites from -340 to -481 bases upstream of the GluR2 AUG codon. The relative use of 5' start sites was different in cortex and cerebellum, indicating complexity of GluR2 transcript expression among different sets of neurons. When GluR2 promoter activity was investigated by plasmid transfection into cultured cortical neurons, cortical glia, and C6 glioma cells, the promoter construct with the strongest activity, per transfected cell, was 29.4-fold (+/- 3.7) more active in neurons than in non-neural cells. Immunostaining of cortical cultures showed that >97% of the luciferase-positive cells also expressed the neuronal marker MAP-2. Evaluation of internal deletion and substitution mutations identified a functional repressor element I RE1-like silencer and functional Sp1 and nuclear respiratory factor-1 (NRF-1) elements within a GC-rich proximal GluR2 promoter region. The GluR2 silencer reduced promoter activity in glia and non-neuronal cell lines by two- to threefold, was without effect in cortical neurons, and could bind the RE1-silencing transcription factor (REST) because cotransfection of REST into neurons reduced GluR2 promoter activity in a silencer-dependent manner. Substitution of the GluR2 silencer by the homologous NaII RE1 silencer further reduced GluR2 promoter activity in non-neuronal cells by 30-47%. Maximal positive GluR2 promoter activity required both Sp1 and NRF-1 cis elements and an interelement nucleotide bridge sequence. These results indicate that GluR2 transcription initiates from multiple sites, is highly neuronal selective, and is regulated by three regulatory elements in the 5' proximal promoter region.
| S-EPMC6792970 | biostudies-literature
Project description:Post-transcriptional gene regulation controls the amount of protein produced from an individual mRNA by altering rates of decay and translation. Many sequence elements that direct post-transcriptional regulation have been found; in mammals, most such elements are located within the 3' untranslated regions (3'UTRs). Comparative genomic studies demonstrate that mammalian 3'UTRs contain extensive conserved sequence tracts, yet only a small fraction corresponds to recognized elements, implying that many additional novel elements exist. Despite a variety of computational, molecular, and biochemical approaches, identifying functional 3'UTRs elements remains difficult.We created a high-throughput cell-based screen that enables identification of functional post-transcriptional 3'UTR regulatory elements. Our system exploits integrated single-copy reporters, which are expressed and processed as endogenous genes. We screened many thousands of short random sequences for their regulatory potential. Control sequences with known effects were captured effectively using our approach, establishing that our methodology was robust. We found hundreds of functional sequences, which we validated in traditional reporter assays, including verifying their regulatory impact in native sequence contexts. Although 3'UTRs are typically considered repressive, most of the functional elements were activating, including ones that were preferentially conserved. Additionally, we adapted our screening approach to examine the effect of elements on RNA abundance, revealing that most elements act by altering mRNA stability.We developed and used a high-throughput approach to discover hundreds of post-transcriptional cis-regulatory elements. These results imply that most human 3'UTRs contain many previously unrecognized cis-regulatory elements, many of which are activating, and that the post-transcriptional fate of an mRNA is largely due to the actions of many individual cis-regulatory elements within its 3'UTR.
| S-EPMC4778349 | biostudies-literature
Project description:Understanding the interaction between human genome regulatory elements and transcription factors is fundamental to elucidate the structure of gene regulatory networks. Here we present CONREL, a web application that allows for the exploration of functionally annotated transcriptional 'consensus' regulatory elements at different levels of abstraction. CONREL provides an extensive collection of consensus promoters, enhancers and active enhancers for 198 cell-lines across 38 tissue types, which are also combined to provide global consensuses. In addition, 1000 Genomes Project genotype data and the 'total binding affinity' of thousands of transcription factor binding motifs at genomic regulatory elements is fully combined and exploited to characterize and annotate functional properties of our collection. Comparison with other available resources highlights the strengths and advantages of CONREL. CONREL can be used to explore genomic loci, specific genes or genomic regions of interest across different cell lines and tissue types. The resource is freely available at https://bcglab.cibio.unitn.it/conrel.
| S-EPMC7805434 | biostudies-literature
Project description:We sought exonic transcriptional regulatory elements by shotgun cloning human cDNA fragments into luciferase reporter vectors and measuring the resulting expression levels in liver cells. We uncovered seven regulatory elements within coding regions and three within 3' untranslated regions (UTRs). Two of the putative regulatory elements were enhancers and eight were silencers. The regulatory elements were generally but not consistently evolutionarily conserved and also showed a trend toward decreased population diversity. Furthermore, the exonic regulatory elements were enriched in known transcription factor binding sites (TFBSs) and were associated with several histone modifications and transcriptionally relevant chromatin. Evidence was obtained for bidirectional cis-regulation of a coding region element within a tubulin gene, TUBA1B, by the transcription factors PPARA and RORA. We estimate that hundreds of exonic transcriptional regulatory elements exist, an unexpected finding that highlights a surprising multi-functionality of sequences in the human genome.
| S-EPMC3454335 | biostudies-literature
Project description:The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UD(MEL), and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.
| S-EPMC3912481 | biostudies-literature
Project description:Uncoupling protein 1 (UCP1) permits non-shivering thermogenesis (NST) when highly expressed in brown adipose tissue (BAT) mitochondria. Exclusive to placental mammals, BAT has commonly been regarded to be advantageous for thermoregulation in hibernators, small-bodied species, and the neonates of larger species. While numerous regulatory control motifs associated with UCP1 transcription have been proposed for murid rodents, it remains unclear whether these are conserved across the eutherian mammal phylogeny and hence essential for UCP1 expression. To address this shortcoming, we conducted a broad comparative survey of putative UCP1 transcriptional regulatory elements in 139 mammals (135 eutherians). We find no evidence for presence of a UCP1 enhancer in monotremes and marsupials, supporting the hypothesis that this control region evolved in a stem eutherian ancestor. We additionally reveal that several putative promoter elements (e.g., CRE-4, CCAAT) identified in murid rodents are not conserved among BAT-expressing eutherians, and together with the putative regulatory region (PRR) and CpG island do not appear to be crucial for UCP1 expression. The specificity and importance of the upTRE, dnTRE, URE1, CRE-2, RARE-2, NBRE, BRE-1, and BRE-2 enhancer elements first described from rats and mice are moreover uncertain as these motifs differ substantially-but generally remain highly conserved-in other BAT-expressing eutherians. Other UCP1 enhancer motifs (CRE-3, PPRE, and RARE-3) as well as the TATA box are also highly conserved in nearly all eutherian lineages with an intact UCP1. While these transcriptional regulatory motifs are generally also maintained in species where this gene is pseudogenized, the loss or degeneration of key basal promoter (e.g., TATA box) and enhancer elements in other UCP1-lacking lineages make it unlikely that the enhancer region is pleiotropic (i.e., co-regulates additional genes). Importantly, differential losses of (or mutations within) putative regulatory elements among the eutherian lineages with an intact UCP1 suggests that the transcriptional control of gene expression is not highly conserved in this mammalian clade.
| S-EPMC5611445 | biostudies-literature
Project description:Transcription factors control cell-specific gene expression programs by binding regulatory elements and recruiting cofactors and the transcription apparatus to the initiation sites of active genes. One of these cofactors is cohesin, a structural maintenance of chromosomes (SMC) complex that is necessary for proper gene expression. We report that a second SMC complex, condensin II, is also present at transcriptional regulatory elements of active genes during interphase and is necessary for normal gene activity. Both cohesin and condensin II are associated with genes in euchromatin and not heterochromatin. The two SMC complexes and the SMC loading factor NIPBL are particularly enriched at super-enhancers, and the genes associated with these regulatory elements are especially sensitive to reduced levels of these complexes. Thus, in addition to their well-established functions in chromosome maintenance during mitosis, both cohesin and condensin II make important contributions to the functions of the key transcriptional regulatory elements during interphase.
| S-EPMC3841252 | biostudies-literature
Project description:Modifications to the global run-on and sequencing (GRO-seq) protocol that enrich for 5'-capped RNAs can be used to reveal active transcriptional regulatory elements (TREs) with high accuracy. Here, we introduce discriminative regulatory-element detection from GRO-seq (dREG), a sensitive machine learning method that uses support vector regression to identify active TREs from GRO-seq data without requiring cap-based enrichment (https://github.com/Danko-Lab/dREG/). This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Predicted TREs are more enriched for several marks of transcriptional activation—including expression quantitative trait loci, disease-associated polymorphisms, acetylated histone 3 lysine 27 (H3K27ac) and transcription factor binding—than those identified by alternative functional assays. Using dREG, we surveyed TREs in eight human cell types and provide new insights into global patterns of TRE function.
| S-EPMC4507281 | biostudies-literature