Project description:16S-V4 rRNA gene sequence data for intestinal biopsies from NCT02749630 trial participants. Biopsies from patients were collected at screening, day 30, and day 85 and prepared for 16SV4 rRNA gene sequencing.
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.
Project description:Fecal 16S-V4 rRNA gene sequence data from NCT02749630 healthy volunteers. Stool samples were collected at screening as well as on days 29, 43, 64, 85, and 134 processed for 16SV4 rRNA gene sequencing
Project description:Fecal 16S-V4 rRNA gene sequence data from NCT02749630 ulcerative colitis patients. Stool samples were collected at screening as well as on days 29, 43, 64, 85, and 134 processed for 16SV4 rRNA gene sequencing
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach. Phylogenetic study of the Treponema taxa found in digital dermatitis lesions of Holstein cows.
Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.