Dataset Information

Hhigh-throughput sequencing of in vitro fecal fermentation samples

ABSTRACT: We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

ORGANISM(S): feces metagenome

PROVIDER: GSE208665 | GEO | 2022/07/27

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:We developed a high-throughput mutagenesis screen to comprehensively identify the cis-regulatory elements that control a target splicing event from the MST1R gene that codes for the RON receptor tyrosine kinase. Skipping of alternative exon 11 results in a constitutively active isoform that promotes epithelial to mesenchymal transition and thereby contributes to the invasive phenotype of tumors. First, we created a library of mutated minigenes via mutagenic PCR. Importantly, the reverse primer introduced a random barcode sequence which labels the associated mutations. Next, the plasmid library was transfected as a pool and depending on the mutations, the transcripts exhibit changes in alternative splicing. The minigene library and the splicing outcome were analyzed by next-generation sequencing and subsequent integration of the datasets resulted in a map of splicing regulatory sites. The RNA-seq experiment was performed to quantify the transcript isoforms and sequence their associated barcodes in order to characterize the splicing outcome of the minigene library in HEK293T cells. For preparation of high-throughput RNA sequencing (RNA-seq) libraries, the total RNA obtained from transfected HEK293T cells was enriched for mRNA by performing polyA selection of 20 µg of total RNA using Dynabeads® Oligo (dT)25 beads (Invitrogen) according to the manufacturer’s protocol. Reverse transcription was carried out using 500 ng of enriched mRNA under the abovementioned conditions. To prevent the formation of chimeric amplicons, the libraries were amplified using emulsion PCR (PMID: 16791213), with Phusion DNA Polymerase (NEB) and either cDNA derived from polyA-selected RNA in the case of RNA-seq or plasmid DNA of the minigene library in the case of high-throughput DNA sequencing (DNA-seq). To amplify fragments for RNA-seq, the following primers containing Illumina sequencing adaptors were used: 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTNNNNNNNNNNGTTCCACTGAAGCCTGAG-3′ (forward primer) and 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNATAGAATAGGGCCCTCTAGA-3′ (reverse primer). PCR products were purified using Agencourt AMPure XP beads (Beckman Coulter). Purified products were first analysed with the TapeStation 2200 capillary gel electrophoresis instrument (Agilent) and then fluorimetrically quantified using a Qubit fluorimeter (Thermo Scientific). Sequencing was carried out on the Illumina MiSeq platform using paired-end reads of 300 nt length and a 10% PhiX spike-in to increase sequence complexity.

Dataset Information

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets