Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Genetic variantion data for LYC

ABSTRACT: The SNP and indel (length less than 50bp) data from large yellow croaker (Larimichthys crocea)

INSTRUMENT(S): Illumina HiSeq 2000

ORGANISM(S): Larimichthys Crocea

SUBMITTER: Key Laboratory of Healthy Mariculture for the East China Sea, Jimei University

PROVIDER: PRJEB22261 | EVA | 2017-11-18

REPOSITORIES: EVA

ACCESS DATA

Json Xml

Similar Datasets

Dindel: Accurate indel calls from short read data

Project description:Dindel: Accurate indel calls from short read data

| PRJEB2293 | ENA

Baiting out a full length sequence from unmapped RNA-seq data

Project description:Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.

2021-04-22 | GSE172487 | GEO

Natural genetic variation caused by small insertions and deletions in the human genome

Project description:We identified 1.96 million small insertions and deletions (INDELs) in the genomes of 79 diverse humans. 10,003 of these INDELs were probed on a custom INDEL genotyping array.

2011-04-19 | GSE27889 | GEO

Corynebacterium glutamicum

Project description:Resequencing and comparative genomics for SNP/InDel indentification

| PRJDB1804 | ENA

Project description:SNP and Indel related to salt and alkali

| PRJNA755748 | ENA

Mapping autism risk loci using genetic linkage and chromosomal rearrangements

Project description:Autism spectrum disorders (ASD) are common, heritable neurodevelopmental conditions. The genetic architecture of ASD is complex, requiring large samples to overcome heterogeneity. Here we broaden coverage and sample size relative to other studies of ASD by using Affymetrix 10K single nucleotide polymorphism (SNP) arrays and 1168 families with = 2 affected individuals to perform the largest linkage scan to date, while also analyzing copy number variation (CNV) in these families. Linkage and CNV analyses implicate chromosome 11p12-p13 and neurexins, respectively, amongst other candidate loci. Neurexins team with previously-implicated neuroligins for glutamatergic synaptogenesis, highlighting glutamate-related genes as promising candidates for ASD. Keywords: Autism spectrum disorder, Affymetrix SNP genotyping, linkage analysis, copy number analysis, chromosomal rearrangements.

2007-02-20 | GSE6754 | GEO

Next Generation Sequencing For Quantitative Analysis Of Hepatic Transcriptomes In Response To Squalene in Swine model

Project description:Purpose: The goal of this study was to determine squalene effect on hepatic transcriptome by comparing high-throughput data for tested group vs. control group in male Large White x Landrace Large swine animals Method: Study the Hepatic mRNA profile of swine animals in response to a steatotic diet supplied with 0.5% squalene over a month by Transcriptome sequencing using DNBseq platform. Sequence reads that passed quality filters were mapped onto reference genome, followed by SNP & INDEL variants calling and Gene expression detection. Results: Squalene intake did not significantly influence single nucleotide polymorphisms. When alternative splicing events were tested, squalene administration had significant influence on splicing events including alternative 5' splicing, alternative 3' splicing , retained intron, skipped exons and mutually exclusive exons. Splicing patterns led to variety of differentially splicing genes and a variety of different isoforms from one gene. Differentially expressed genes were 18,659 in the squalene group and 18,602 in control group.

2023-08-30 | GSE214732 | GEO

“Like Sugar in Milk”: Reconstructing the genetic history of the Parsi population

Project description:Genomewide SNP data of Parsi population of India has been used to study their origin and migration.

2017-05-18 | GSE97086 | GEO

Affymetrix SNP Data array data of pancreatic cancer PDX models

Project description:Affymetrix SNP Data array data of pancreatic cancer PDX models

| PRJNA803543 | ENA

Affymetrix SNP-array data for splenic diffuse red pulp lymphoma samples

Project description:Deep characterization of a large series of splenic diffuse red pulp lymphomas DNA from 5 tumor samples, corresponding to 4 cases, were analyzed with Affymetrix SNP 6.0 platform for copy number alteration study.

2017-12-23 | GSE65052 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data