HP Prostate MSK-IMPACT
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina HiSeq 2000
ORGANISM(S): Homo Sapiens
SUBMITTER: MSKCC
PROVIDER: PRJEB33969 | EVA | 2019-08-12
REPOSITORIES: EVA
Dataset's files
Items per page: 5 1 - 5 of 49 |
Similar Datasets
Project description:1134 primary and metastatic colorectal tumor samples sequenced with MSK-IMACT, a hybridization capture-based next-generation sequencing assay. Custom DNA probes were designed for targeted sequencing of all exons and selected introns of 341, 410, or 468 genes.
2017-12-09 | PRJEB23844 | EVA
Project description:Here we present clear patterns of age-associated changes in DNA methylation in the aquatic vertebrate species Xenopus tropicalis. We selected approximately 3500 sites highly correlated with age from WGBS data from 9 frogs of 3 different age groups (young, approx. 1 year old; mature, approx. 5 years old; old, approx. 9 years old - GSE221656) and designed probes for the development of cost effective targeted bisulfite sequencing (TBSeq) assay. Here, we present the TBSeq assay in sixteen different frogs as a pilot experiment to validate our previous findings.
2023-04-28 | GSE222107 | GEO
Project description:Targeted sequencing of genome is essential to the basic biological research and biomedicine. Therefore, various targeted enrichment methods have been developed for this end, in which various hybridization-based methods have been most widely used. However, the current hybridization-based methods (both on solid or in solution) are still restricted by the intrinsic shortcomings of nucleic acid hybridization. In this study, by combining an engineered dCas9-sgRNA with widely used magnetic isolation, we developed a new strategy to enrich target genomic DNAs in high efficiency. In this strategy, target DNA was firstly specifically recognized and bound by a complex of dCas9 and capture sgRNA (csgRNA). The DNA-dCas9-csgRNA complex was then captured on magnetic beads through the annealing of elongated 3′ end of csgRNA with single-stranded capture oligonucleotides coupled on streptavidin-coated magnetic beads. We thus named the strategy as CRISPR-assistant target enrichment (CATE). The enriched DNAs can be analyzed by the next generation sequencing (NGS). We thus named the technique as CATE-seq. Used the technique, we successfully enriched 35 target exons of 6 genes in 6 cell lines by using 54 csgRNA. We found that the target genomic DNA fragments such as exons could be efficiently enriched and analyzed by CATE-seq. The technique has several significant advantages over the current hybridization-based methods, including high simplicity, specificity, sensitivity, and throughput. This study therefore provides a new powerful tool for targeted sequencing.
2018-09-15 | GSE119994 | GEO
Project description:Due to the large size, complex splicing and wide dynamic range of eukaryotic transcriptomes, RNA sequencing samples the majority of expressed genes infrequently, resulting in sparse sequencing coverage that can hinder robust isoform assembly and quantification. Targeted RNA sequencing addresses this challenge by using oligonucleotide probes to capture selected genes or regions of interest for focused sequencing. This enhanced sequencing coverage confers sensitive gene discovery, robust transcript assembly and accurate gene quantification. Here we describe a detailed protocol for all stages of targeted RNA sequencing, from initial probe design considerations, capture of targeted genes, to final assembly and quantification of captured transcripts. Initial probe design and final analysis can take less than a day, while the central experimental capture stage requires ~7 days. Targetted RNA sequencing of long noncoding RNAs
2014-03-01 | E-GEOD-52503 | biostudies-arrayexpress
Project description:Colorectal cancer arises in part from the cumulative effects of multiple gene lesions. Recent studies in selected cancer types have revealed significant intra-tumor genetic heterogeneity and highlighted its potential role in disease progression and resistance to therapy. We hypothesized the existence of significant intra-tumor genetic heterogeneity in rectal cancers involving variations in localized somatic mutations and copy number abnormalities. Two or three spatially disparate areas from each of six rectal tumors were dissected and subjected to next-generation whole exome DNA sequencing, Oncoscan SNP arrays, and targeted confirmatory sequencing and analysis. The resulting data were integrated to define subclones using SciClone. Mutant-allele tumor heterogeneity (MATH) scores, mutant allele frequency correlation, and mutation percent concordance were calculated, and Copy number analysis including measurement of correlation between samples was performed. Affymetrix OncoScan V3 arrays were run on all tumor samples. The OncoScan array platform consists of a set of 217k probes designed specifically for profiling tumors. The overall resolution of the assay for detecting copy number change generates data at 50-100kb resolution across a set of 891 cancer genes, and 300-400kb across the rest of the genome. Raw array florescence intensity data generated on the Affymetrix scanners in the form of CEL files were loaded into the OncoScan Console software v.1.1.0 (Affymetrix, Santa Clara, California). Quality control statistics as well as integrated OSCHP files were generated by OncoScan Console. The standard Affymetrix reference control file for OncoScan data was used for processing the arrays.
2015-09-24 | E-GEOD-73365 | biostudies-arrayexpress
Project description:Due to the large size, complex splicing and wide dynamic range of eukaryotic transcriptomes, RNA sequencing samples the majority of expressed genes infrequently, resulting in sparse sequencing coverage that can hinder robust isoform assembly and quantification. Targeted RNA sequencing addresses this challenge by using oligonucleotide probes to capture selected genes or regions of interest for focused sequencing. This enhanced sequencing coverage confers sensitive gene discovery, robust transcript assembly and accurate gene quantification. Here we describe a detailed protocol for all stages of targeted RNA sequencing, from initial probe design considerations, capture of targeted genes, to final assembly and quantification of captured transcripts. Initial probe design and final analysis can take less than a day, while the central experimental capture stage requires ~7 days.
2014-03-01 | GSE52503 | GEO
Project description:Despite relevant clinical and/or familial presentations suggesting a hereditary predisposition (early-onset, multiple primary tumors, familial aggregation), targeted genomic analysis based on the phenotype are often non contributive. As somatic cancer genes are limited, the hypothesis is that the targeted next-generation sequencing of 200 genes, selected for their implications in cancers may contribute to the understanding of many selected patients’ presentation by the identification of germline deleterious mutations, and may identified phenotype overlapping and/or mosaicisms. The focus will be put on early-onset breast, ovarian, colorectal cancer or pediatric cancers and multiple primary tumors.
| 2206884 | ecrin-mdr-crc
Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/
2011-09-12 | E-GEOD-29040 | biostudies-arrayexpress
Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic gene deserts. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/
2011-09-12 | E-GEOD-29038 | biostudies-arrayexpress
Project description:<p>Targeted massively parallel sequencing analysis was conducted on DNA extracted from archived 22-28 year old, formalin-fixed primary breast tumors from 625 patents from British Columbia treated with five years of adjuvant tamoxifen monotherapy and followed for over 10 years. Genes were selected for targeted sequencing by review of existing large-scale breast cancer sequencing studies and breast cancer literature. In total, 83 genes were identified and 3,029 probes were designed to tile across all known exons. Illumina sequencing libraries were constructed, indexed, pooled, and enriched for target sequences by hybrid-capture followed by sequencing of paired-end 100bp reads. All samples met minimum quality controls of 80% targeted space covered at 20X or greater. On average, each sample had 336M aligned bases and a mean coverage of 135.8X.</p>
| phs001234 | dbGaP