Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Cardiac endothelial in vivo responses to LPS

ABSTRACT: Transcriptional responses of cardiac endothelial cells isolated from Tie-2 GFP mice 4 h and 24 h after intraperitoneal LPS injection. Operon V1 long oligo set. Hybridization using Cy3 and Cy5 labeled amplified RNA. Keywords: parallel sample

ORGANISM(S): Mus musculus

PROVIDER: GSE1042 | GEO | 2004/02/26

SECONDARY ACCESSION(S): PRJNA89919

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

In vivo LPS effects on cardiac endothelial RNA-15K cDNA array

Project description:Cardiac endothelial RNA from Tie-2 GFP mice exposed to intraperitoneal LPS vs. saline, 4 h. RNA amplified 2 rounds. Experiment and dye reversal with cy5, cy3. Keywords: parallel sample

2004-02-26 | GSE1038 | GEO

In vivo LPS effects on cardiac endothelial RNA-15K cDNA array

Project description:Cardiac endothelial RNA from Tie-2 GFP mice exposed to intraperitoneal LPS vs. saline, 4 h. RNA amplified 2 rounds. Experiment and dye reversal with cy5, cy3.

2010-06-09 | E-GEOD-1038 | biostudies-arrayexpress

Gene expression profiles of various tissues under different physiological conditions

Project description:Rice is one of important crop and, the genome has been already completely sequenced. Moreover we collected more than 30K rice FL-cDNA clones as transcriptome resources. However, the cDNA collection did not reveal the transcription activity and specificity of expression. So, we designed 60-mer oligo array based on the array system of Agilent Technologies (GPL477) as custom array. For validation of the array, we tested the reproducibility of labeling and hybridization. After this validation, 22K rice oligo array was supplied from Agilent Technologies (GPL892). 1: reproducibility of labeling: mRNA of shoot sample was amplified and labeled more than 10 times with Cy3 and Cy5, and both Cy3- and Cy5-labeled cRNA was hybridized on a slide (self-hybridization), and validate the reproducibility of labeling. In addition, we also amplified and labeled mRNA of other samples with Cy3 and Cy5, and made a self-hybridization. The intensity data of these array was also indicated transcription activity of genes in these samples. Keywords: variety among tissues

2008-04-01 | GSE7530 | GEO

DNA methylation profiling of ductal carcinoma in situ (DCIS)

Project description:Methylated genomic fragments from tumor DNA and matching normal control were enriched with the methylated-CpG island recovery assay (MIRA); amplified, labeled and hybridized on Agilent CpG island tiling oligo arrays. MIRA enriched samples from tumor were labeled with Cy5 while MIRA enriched DNA samples from normal tissue were labeled with Cy3. Keywords: Cancer

2009-02-18 | GSE14865 | GEO

Methylation profiling of lung squamous cell carcinomas vs surrounding normal tissue

Project description:Methylated genomic fragments from tumor and matching normal DNA were enriched with the methylated-CpG island recovery assay (MIRA); amplified, labeled and hybridized on Agilent CpG island tiling oligo arrays. Samples from tumor were labeled with Cy5 while the matching normal were labeled with Cy3 so that methylation differences can be detected. Keywords: Cancer

2007-11-17 | GSE9622 | GEO

In vitro LPS response of SVEC cells

Project description:SVEC cell cultures exposed to LPS vs control. 4 and 24 h. Operon V1. Hybridization with amplified RNA. Keywords: parallel sample

2004-02-26 | GSE1043 | GEO

Spleen vs Lipopolysaccharide (LPS) Treated B cell

Project description:total RNA from mouse (male c57BL/6) spleen labeled with Cy3 vs total RNA from mouse (male c57BL/6) B cells treated with Lipopolysaccharide (LPS) labeled with Cy5- time course with repeats Keywords: ordered

2003-04-14 | GSE389 | GEO

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).

2012-08-23 | GSE39572 | GEO

Contribution of unique genes by individual cell lines to Universal Mouse Reference RNA

Project description:RNA from 11 individual mouse cell lines were reverse-transcribed to cDNA, labeled with Cy5 and cohybridized with Cy3-labeled UMRR onto 7,500-spot mouse oligo microarrays (UNC). The data was analyzed using GeneTraffic software. 300-1000 spots out of 8,000 were flagged on each microarray and excluded from further analysis. Spots with hybridization signals in Cy5 channel higher than 1000 and with Cy5/Cy3 ratio greater than 2 were collected and the number of spots with these characteristics on only one microarray was determined. A reference experiment design type is where all samples are compared to a common reference. Keywords: reference_design

2006-01-05 | GSE3974 | GEO

Fibroblast-like synoviocytes derived from patients with rheumatoid arthritis

Project description:Fibroblast-like synoviocytes (FLS) were cultured from synovial tissues from 19 RA patients. RNA was isolated using the Fast Track 2.0 kit (Invitrogen, Carlsbad, California)from the FLS cultures. Fluorescent cDNA probes were prepared from 1 ug experimental mRNA by oligo dT-primed polymerization using Superscript II reverse transcriptase in the presence of Cy5 labeled dCTP. A common reference mRNA sample (CRE) that consists of a mixture of mRNAs isolated from 11 different cell-lines, was labeled with Cy3. The Cy5 and Cy3 labeled cDNAs were pooled and hybridized to a 24,000 cDNA microarray. Set of arrays that are part of repeated experiments Keywords: Biological Replicate

2006-01-19 | GSE4061 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data