Gut microbiota analysis associated with hepatocellular carcinoma
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE108847 | GEO | 2019/02/27
REPOSITORIES: GEO
Similar Datasets
Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
2019-02-08 | GSE98944 | GEO
Project description:Here we report 16S rRNA data in gut microbiota of autism spectrum disorders compared with healthy volunteers. A total of 1322 operational taxonomic units (OTUs) were identified in the sequence data. The Bacteroidetes and Firmicutes were both dominated phylum in ausitic subjects and healthy controls. Phylum level analysis showed a clear alteration of the bacterial gut community in ASD characterized by a higher Firmicutes (P < 0.05), Proteobacteria (P < 0.001), and Actinobacteria (P < 0.001) than that in healthy controls. However, Bacteroidetes were significantly decreased in ASD patients (P < 0.001).
2020-09-30 | GSE113690 | GEO
Project description:Familial Mediterranean fever (FMF) is an inflammatory genetic disease characterized by elevated systemic reactivity against commensal gut microbiota and high levels of gut Candida albicans. The current study investigated the effects of Lactobacillus acidophillus INMIA 9602 Er 317/402 strain (probiotic “Narine”) on the relative abundance of gut enteric bacteria, lactobacilli, Staphylococcus aureus, and Enteroccocus faecalis in Candida albicans-carrier and non-carrier FMF patients in remission with the main MEFV mutation patterns M694V/V726A- the prevalent MEFV gene mutation within FMF patients in the Armenian cohort. Our data revealed that M694V/V726A mutations in PURIN inflammasome leading to FMF disease brought to gender specific differences in microbial community structure in FMF patients. Possibly, long-term colchicine use suppresses the PURIN inflammasome/inhibits NLRP3 inflammasome-dependent IL-1β release influencing on overgrowth of C. albicans in gut microbiota of FMF patients. The comparison of Operational Taxonomic Units (OTUs) of enteric bacteria in C. albicans-carrier and non-carrier female patients revealed the statistically significant increase in OTUs of enterobacteria in C. albicans-carriers. In contrast to this, there were no differences in abundance of Enteroccocus faecalis between female FMF C. albicans-carriers compared with non-carriers, while male FMF C. albicans-carriers have increased abundance of E. faecalis in their gut microbiota compared with that of male patients with none carriers. The gut microbiota of FMF patients (both male and female) with C. albicans below baseline level contains high abundance of lactobacilli compared with C. albicans-carriers. The adoption of Lactobacillus acidophilus INMIA 9602 Er 317/402 leads to changes in gut microbiota composition of FMF patients. It reduces, in particularly, the abundance of enterobacteria in females, and Enteroccocus faecalis in men parallel with reducing the numbers of yeast in gut microbiota of FMF patients. We hypothesize that colchicine treatment changes the already-altered gut microbiota of FMF patients, thereby affecting the regulation of immune system by inhibition of NLRP3 inflammasome. Colchicine could lead to overgrowth of C. albicans in gut microbiota of FMF patients, whereas the Lactobacillus acidophilus INMIA 9602 Er 317/402 works on activation of inflammasome by new changes in gut microbiota of patients.
2018-03-16 | GSE111835 | GEO
Project description:Purpose: To gain molecular insights of HBV integration that may contribute to HCC tumorigenesis, we performed whole transcriptome sequencing and whole genome copy number profiling of hepatocellular carcinoma (HCC) samples from 50 Chinese patients. Results: We identified a total of 33 HBV-human integration sites in 16 of 44 HBV-positive HCC tissues, which were enriched in HBV genotype C-infected patients. In addition, significantly recurrent HBV-MLL4 integration (18%). This dataset is part of the TransQST collection.
2015-03-31 | E-GEOD-65485 | biostudies-arrayexpress
Project description:Purpose: To gain molecular insights of HBV integration that may contribute to HCC tumorigenesis, we performed whole transcriptome sequencing and whole genome copy number profiling of hepatocellular carcinoma (HCC) samples from 50 Chinese patients. Results: We identified a total of 33 HBV-human integration sites in 16 of 44 HBV-positive HCC tissues, which were enriched in HBV genotype C-infected patients. In addition, significantly recurrent HBV-MLL4 integration (18%; 8/44) was found in this cohort of patients. Conclusions: This is the first report on the molecular basis of the MLL4 integration driving MLL4 over-expression. HBV-MLL4 integration occurred frequently in Chinese HCC patients, representing a unique molecular segment for HCC with HBV infection.
2015-03-31 | GSE65485 | GEO
Project description:Purpose: To gain molecular insights of HBV integration that may contribute to HCC tumorigenesis, we performed whole transcriptome sequencing and whole genome copy number profiling of hepatocellular carcinoma (HCC) samples from 50 Chinese patients. Conclusions: This is the first report on the molecular basis of the MLL4 integration driving MLL4 over-expression. HBV-MLL4 integration occurred frequently in Chinese HCC patients, representing a unique molecular segment for HCC with HBV infection. We profiled 50 Chinese Hepatocellular Carcinoma patients and 14 adjacent tissues using Agilent 244K array CGH technology. 50 Tumor samples also did RNASeq profiling.
2015-03-30 | E-GEOD-65484 | biostudies-arrayexpress
Project description:Purpose: To gain molecular insights of HBV integration that may contribute to HCC tumorigenesis, we performed whole transcriptome sequencing and whole genome copy number profiling of hepatocellular carcinoma (HCC) samples from 50 Chinese patients. Conclusions: This is the first report on the molecular basis of the MLL4 integration driving MLL4 over-expression. HBV-MLL4 integration occurred frequently in Chinese HCC patients, representing a unique molecular segment for HCC with HBV infection.
2015-03-30 | GSE65484 | GEO
Project description:Purpose: Chronic Hepatitis B virus (HBV) infection leads to liver fibrosis which is a major risk factor in Hepatocellular carcinoma (HCC) and an independent risk factor of recurrence after HCC tumor resection. HBV genome can be inserted into human genome, and chronic inflammation may trigger somatic mutations. Several studies characterized HBV integration sites in HCC patients with regard to frequently occurring hotspots. However, how HBV integration and other genomic changes contribute to the risk of tumor recurrence with regard to different degree of liver fibrosis is not clearly understood. In this study, we aim to find potential molecular mechanisms underlying tumor recurrence of HBV-associated HCC (HBV-HCC) with different degree of liver fibrosis. Methods: We performed RNA sequencing of 21 pairs of tumor and non-neoplastic liver tissues of HBV-HCC patients and performed comprehensive genomic analysis of our RNAseq data and public available sequencing data related to HBV-HCC. We developed a robust pipeline for sensitively identifying HBV integration sites based on sequencing data. Simulations with sequencing data showed that our method outperformed existing methods. We also compared SNPs of each sample with SNPs in cancer census database and inferred patient’s pathogenic SNP loads in tumor and non-neoplastic liver tissues. Conclusions: The HBV-integration and pathogenic SNP load patterns for HCC recurrence risk vary depending on liver fibrosis stage, suggesting potentially different tumorigenesis mechanisms for low and high liver fibrosis patients.
2018-03-01 | GSE94660 | GEO
Project description:We applied small RNA Solexa sequencing technology to identify microRNA expression in human liver samples from surgically removed liver tissues including three normal liver tissues (distal normal liver tissue of liver hemangioma), an hepatitis B virus (HBV)-infected liver, a severe chronic hepatitis B liver, two HBV-related hepatocellular carcinoma (HCC), an hepatitis C virus (HCV)-related HCC, and an HCC without HBV or HCV infection. All samples were collected with the informed consent of the patients and the experiments were approved by the ethics committee of Second Military Medical University, Shanghai, China. We investigated the miRNome in human normal liver and suggested some deregulated abundantly expressed microRNAs in HCC. center_name: National Key Laboratory of Medical Immunology & Institute of Immunology, Second Military Medical University, Shanghai, China. Examination of miRNome in human liver samples from surgically removed liver tissues including three normal liver tissues (distal normal liver tissue of liver hemangioma), an hepatitis B virus (HBV)-infected liver tissue, a severe chronic hepatitis B liver tissue, an HBV-related hepatocellular carcinoma (HCC) tissue and adjacent liver tissues of different regions,an HBV-related HCC tissue and adjacent liver tissue, an hepatitis C virus (HCV)-related HCC tissue and adjacent liver tissue, and an HCC without HBV or HCV infection and adjacent liver tissue. All 15 human liver tissue samples.
2010-04-10 | E-GEOD-21279 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO