Dataset Information

High-throughput sequencing of in vitro fecal fermentation samples

ABSTRACT: We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

ORGANISM(S): human feces metagenome

PROVIDER: GSE199749 | GEO | 2022/04/02

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:The tracks show enrichment of RNA sequence tags generated by high throughput sequencing (RNA-seq) and mapped to the human genome. Double stranded cDNA was synthesized from polyadenylated RNA (polyA+) . PCR amplified, adapter ligated cDNA, 150-300nt long, was sequenced on an Illumina GA sequencer. Where designated, cell lines received specific treatments prior to RNA isolation. As indicated, K562 cells were treated with either interferon-a or interferon-g for 30 minutes or 6 hours. These experiments were carried out in conjunction with ChIP-Seq experiments on the transcription factors STAT1 and STAT2 in order to examine the effects that inducers of a specific transcriptional response might have on gene expression and on transcription factor binding site discovery. K562 cells were treated with a-amanitin in order to examine the effects of RNA polymerase II inhibition on RNA polymerase III-mediated transcription. This track shows expression data generated as confirmation of the SYDH TFBS (http://genome-preview.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeSydhTfbs) tracks currently available on genome-preview. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf Cells were grown according to the approved ENCODE cell culture protocols (http://hgwdev.cse.ucsc.edu/ENCODE/protocols/cell). Total RNA was extracted using TRIzol reagents (15596-018, Life Tech), following the manufacturer's protocol. For polyA+ samples, polyadenylated RNA was purified using the MicroPoly(A) Purist kit (AM1919, Life Tech) and fragmented using RNA Fragmentation Reagent (AM8740, Life Tech). Illumina adapters were ligated to double stranded cDNA which was synthesized using reagents from Life Tech (11917-010). PCR amplified adapter ligated cDNA (150-300 bp) was sequenced using Illumina GA. Sequence reads of 27-33nt long with 0-2 mismatches were mapped to the genome. The signal height corresponds to the number of overlapping fragments at each nucleotide position in the genome. Samples originally mapped to the hg18 version of the human genome were remapped to hg19 using the BWA aligner, version 0.5.7.

Dataset Information

High-throughput sequencing of in vitro fecal fermentation samples

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets