Transcriptomics

Dataset Information

0

The E. coli global regulator DksA attenuates transcription during T4 infection


ABSTRACT: Purpose: We investigated how deletion of DksA or ppGpp, two E. coli global transcription regulators, affects T4 infection. Method: B606, B606 DdksA, and B606 ppGpp0 were grown at 37C to early/mid log phase (OD600 ~ 0.4) then infected with moi of 10 of either wt T4 or T4motAam and total RNA was isolated. 2.5 µg total RNA from each sample was treated with a Ribo-Zero rRNA Removal Kit (Gram-Negative Bacteria; Illumina San Diego, CA) to deplete rRNA. The enriched mRNA was fragmented, reverse-transcribed, ligated with dual indexes, and amplified using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). The resulting RNA-Seq libraries were pooled at equal concentrations and sequenced using on an Illumina MiSeq to generate 2 x 100 bp paired-end reads. Read data in fastq format was demultiplexed and aligned to E. coli B str. DE3 (NC_012971.2) reference genome using STAR v2.5.2, retaining unmapped reads (Dobin, Davis et al. 2013). Unmapped reads were then mapped in a second step to T4 reference (NC_000866.4). In both cases, default alignment behavior was altered with the following arguments: --outFilterScoreMinOverLread 0 --outFilterMatchNmin 30 --outFilterMatchNminOverLread 0 --clip3pAdapterSeq AGATCGGAAGAGCGTCGTGTA --alignIntronMax 1. RNA gene counts in both reference genomes were then quantified using the same NCBI gene definitions utilized in mapping index construction using the subread featureCounts v1.4.6-p3 package (Liao, Smyth et al. 2014). Differential expression between samples fchanges in gene expression was predetermined to entail a fold change of more than or equal to 2 and P value less than or equal to 0.05. at 5 minutes post-infection. Result: Both ppGpp0 and delta(dksA) increase wt T4 plaque size. However, ppGpp0 does not significantly alter burst size/latent period and only modestly affects T4 transcript abundance, while delta(dskA) increases burst size (2-fold), does not affect latent period, and increases the abundance of several Pe RNAs at 5 min post-transcription. delta(dskA) also increases T4motAam plaque size with a much shorter latent period compared to T4motAam/wt infection, and the levels of specific middle RNAs increase due to more transcription from Pe's that extend into these middle genes. Conclusion: We conclude that DksA attenuates T4 early gene expression. Consequently, delta(dksA) results in a more productive wt infection and ameliorates the poor expression of middle genes in a T4motAam infection.

ORGANISM(S): Tequatrovirus T4

PROVIDER: GSE111808 | GEO | 2018/03/15

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

2011-10-26 | E-GEOD-28795 | biostudies-arrayexpress
2011-10-27 | GSE28795 | GEO
2015-05-31 | GSE63711 | GEO
2010-06-01 | GSE19742 | GEO
| PRJNA438226 | ENA
2021-04-30 | GSE173614 | GEO
2022-09-19 | PXD035873 | Pride
2018-04-21 | GSE113425 | GEO
2015-08-30 | E-GEOD-63690 | biostudies-arrayexpress
2015-11-13 | GSE74921 | GEO