Dataset Information

Expression data from E. coli cells overexpressing either GreA or GreB in ppGpp0 cells in the dksA+ or dksA- background

ABSTRACT: Strains devoid of ppGpp (ΔrelA ΔspoT; called ppGpp0), and ppGpp0 dksA- exhibit several amino acid requirements for growth on minimal media. We found that overexpression of DksA can complement some of those requirements. Since DksA is a factor that binds to the RNA polymerase secondary channel, we wondered if other secondary channel proteins might also exert a similar role with respect to growth on minimal media. In our study we found that GreA and partially GreB can in fact complement these requirements under certain conditions. Here, we wished to investigate a broader effect of GreA and GreB on ppGpp0 and ppGpp0 dksA- strains. Since the parent strains are unable to grow in minimal media, we had to supplement the M9 glucose medium with a set of amino acids (DFHILQSTV). We found that both, GreA and GreB can affect a much larger set of genes in the absence of dksA, than in its presence. Also, GreA seems to affect more genes than GreB, under both conditions. We used microarrays to detail the effects of overproducing either GreA or GreB in cells devoid of ppGpp, in the dksA+ or dksA- background

ORGANISM(S): Escherichia coli

PROVIDER: GSE28795 | GEO | 2011/10/27

SECONDARY ACCESSION(S): PRJNA138813

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Purpose: We investigated how deletion of DksA or ppGpp, two E. coli global transcription regulators, affects T4 infection. Method: B606, B606 DdksA, and B606 ppGpp0 were grown at 37C to early/mid log phase (OD600 ~ 0.4) then infected with moi of 10 of either wt T4 or T4motAam and total RNA was isolated. 2.5 µg total RNA from each sample was treated with a Ribo-Zero rRNA Removal Kit (Gram-Negative Bacteria; Illumina San Diego, CA) to deplete rRNA. The enriched mRNA was fragmented, reverse-transcribed, ligated with dual indexes, and amplified using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). The resulting RNA-Seq libraries were pooled at equal concentrations and sequenced using on an Illumina MiSeq to generate 2 x 100 bp paired-end reads. Read data in fastq format was demultiplexed and aligned to E. coli B str. DE3 (NC_012971.2) reference genome using STAR v2.5.2, retaining unmapped reads (Dobin, Davis et al. 2013). Unmapped reads were then mapped in a second step to T4 reference (NC_000866.4). In both cases, default alignment behavior was altered with the following arguments: --outFilterScoreMinOverLread 0 --outFilterMatchNmin 30 --outFilterMatchNminOverLread 0 --clip3pAdapterSeq AGATCGGAAGAGCGTCGTGTA --alignIntronMax 1. RNA gene counts in both reference genomes were then quantified using the same NCBI gene definitions utilized in mapping index construction using the subread featureCounts v1.4.6-p3 package (Liao, Smyth et al. 2014). Differential expression between samples fchanges in gene expression was predetermined to entail a fold change of more than or equal to 2 and P value less than or equal to 0.05. at 5 minutes post-infection. Result: Both ppGpp0 and delta(dksA) increase wt T4 plaque size. However, ppGpp0 does not significantly alter burst size/latent period and only modestly affects T4 transcript abundance, while delta(dskA) increases burst size (2-fold), does not affect latent period, and increases the abundance of several Pe RNAs at 5 min post-transcription. delta(dskA) also increases T4motAam plaque size with a much shorter latent period compared to T4motAam/wt infection, and the levels of specific middle RNAs increase due to more transcription from Pe's that extend into these middle genes. Conclusion: We conclude that DksA attenuates T4 early gene expression. Consequently, delta(dksA) results in a more productive wt infection and ameliorates the poor expression of middle genes in a T4motAam infection.

Project description:Bacteriophage P1 along with λ and T4 phages are among the best described bacterial viruses in molecular biology. For years, P1 features as well as its life cycle have been studied and its complete genome was published. Undeciphered phenomenon of improved P1vir lytic development in the absence of DksA protein in cell engaged us to more holistic experimental approach. Bacterial wild type and dksA strains were cultured to OD600 = 0.2. Next, P1vir was added, samples were withdrawn at 0, 10 and 30 minutes after P1vir infection. Total RNA was isolated and checked for quality using the Bioanalyzer 2100. The sequencing run was conducted on the Illumina NovaSeq6000 platform. 30 million pair-end reads per samples were assessed with 101 pb read length. Reference P1 phage genome sequence and annotations were downloaded from GenBank. We have discovered many changes in virus transcriptome. For instance: downregulation of phage genes encoding the main repressor of lysogeny C1 or proteins triggering cell lysis (e.g., lysozyme, holin) and upregulation of genes encoding antiholins in dksA mutant. This results support our gentle lysis hypothesis – less efficient lysis, combined with minor improvements of phage development which may lead to higher phage yield in DksA-devoid cells. We have observed upregulated expression of phage genes responsible for virion-parts production in the dksA mutant. Interestingly, expression of lysogeny-related c8 gene is upregulated in the dksA mutant. We speculate that P1vir developing in the dksA host is at the brink of lysogeny but is unable to established it and eventually enters the lytic pathway. We also found some interesting events in host cells upon infection. P1vir is taking control of the cellular protein, sugar and lipid metabolism in both, the wild type and dksA mutant hosts. However, in dksA mutant several genes involved in sulfur metabolism were uniquely upregulated. It remains unclear if this associates with obtaining new energy sources or with global reprograming via H2S signaling functions. Generally, the hosts are reacting by activating SOS response or upregulating the heat shock proteins. But we also found downregulation of proteolysis which was unique for the dksA strain. We believe that this extensive and comprehensive study not only finds reasonable explanations for the improved P1vir development in dksA strain, but also makes a great contribution to the field of P1 phage biology. Funding: This research was funded by the National Science Center, Poland (grant PRELUDIUM 2013/09/N/NZ2/01899 to G.M.C.)

Dataset Information

Expression data from E. coli cells overexpressing either GreA or GreB in ppGpp0 cells in the dksA+ or dksA- background

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets